ADN-Duplicación y Transcripción

Jhon Jairo González
Flashcards by Jhon Jairo González, updated more than 1 year ago
Jhon Jairo González
Created by Jhon Jairo González over 5 years ago
106
5

Description

Pregrado BIOLOGIA Flashcards on ADN-Duplicación y Transcripción, created by Jhon Jairo González on 09/07/2015.

Resource summary

Question Answer
¿Qué significan las siglas del ADN? Ácido desoxirribonucleico
¿Dónde se almacena la información genética de las células animales? En el núcleo celular
¿A que estructura se refiere esta frase? “Son estructuras moleculares de ADN compacto que se pueden visualizar cuando la célula está a punto de dividirse” Cromosomas
Los cromosomas están formados por cuantas unidades y que nombre reciben? Dos cromátides Dos cromátides
El centrómero de un cromosoma es la región: Que contiene los genes menos importantes Que no contiene información genética Que contiene los genes más importantes En la cual se contactan las cromátides En la cual se contactan las cromátides
¿Cuántos cromosomas existen en las células del cuerpo humano? 46
¿Cuál de las siguientes frases es FALSA respecto del ADN de las células aucariotas? - Está formado por und. de nucleótidos - Forma una estructura de alfa-hélice - Es una cadena doble entrelazada -Es circular Es circular
Cuando la célula necesita sintetizar proteínas la cromatina del ADN la encontramos en forma: Laxa, desenrrollada y relajada
¿A qué estructura se refiere esta frase? “Son grandes bloques de nucleótidos que contienen la información para generar una proteína” Gen
Los nucleótidos del ADN están formados por: Una desoxirribosa, un fosfato y una base nitrogenada
¿Cuáles son las 4 bases nitrogenadas presentes en el ADN? Adenina, Guanina, Citocina y Timina
¿Qué son los ácidos nucleicos? a) proteínas b) moléculas ribosomales c) polímeros de nucleótidos d) polímeros de aminoácidos c) polímeros de nucleótidos
¿Cuál de los siguientes grupos no está presente en los ácidos nucleicos? a) pentosa b) fosfato c) colesterol d) base nitrogenada c) colesterol
¿Qué base nitrogenada no forma parte del ADN? adenina, uracilo, citosina ó timina Uracilo
¿Qué función tiene el ácido desoxirribonucleico? a) transporte de proteínas b)contener la información genética para formar al organismo c) interpretación del genoma d) síntesis de moléculas b)contener la información genética para formar al organismo
¿Cuál de las siguientes características no corresponde al ADN? a) posee una doble hélice b) sus cadenas son antiparalelas c) es simple cadena d) sus cadenas son complementarias c) es simple cadena
¿Qué tipo de molécula es la desoxirribosa? a)un ácido graso b) péptido c) un azúcar d) un alcohol c) un azúcar
¿Con qué base de nucleótido se aparea la Adenina? a) A-T b) A-A c) A-C d) A-G a) A-T
El ADN de un procariota es: a) triple cadena b) circular c) segmentado d) monocatenario b) circular
En eucariotas ¿Cómo se denominan las proteínas que estabilizan o enrrollan el ADN? Histonas
¿Qué son los intrones? partes no codificantes del ADN
Que tipo de uniones se da entre las bases nitrogenadas del ADN Puentes de hidrogeno
Cuantos puentes de hidrógeno hay entre la Citosina y la guanina? dos
Cuantos puentes de hidrógeno hay entre la Adenina y la Timina? 3
¿Cuáles son los ácidos nucleicos que se conocen? ADN (ácido desoxirribonucleico) y ARN (ácido ribonucleico).
¿Cómo está constituido cada nucleótido? Cada nucleótido está constituido por: un azúcar (pentosa), un grupo fosfato y por bases nitrogenadas (varía entre los nucleótidos).
Las bases nitrogenadas que conforman el grupo de las pirimidinas son: Uracilo, Timina y Citosina.
¿Cuál es la diferencia que existe entre ADN y ARN si debemos considerar las bases nitrogenadas que conforman dichos ácidos nucleicos? La diferencia es que el ADN está conformado por: Adenina, Citosina, Timina y Guanina. Mientras que en el caso de el ARN está conformado por: Adenina, Citosina, Guanina y Uracilo.
Falso o verdadero con respecto al ADN: Es una molécula bicatenaria (dos cadenas idénticas con dirección 5´-3´), conformada por: una pentosa (desoxirribosa), un grupo fosfato y 4 bases nitrogenadas (adenina, timina, guanina y citosina). Falso
Falso o verdadero con respecto al ADN: Es una molécula bicatenaria (dos cadenas complementarias), conformada por: una pentosa (desoxirribosa), un grupo fosfato y 4 bases nitrogenadas (adenina, uracilo, guanina y citosina). FALSO
Falso o verdadero con respecto al ADN: Es una molécula bicatenaria (una cadena simple), conformada por: una pentosa (desoxirribosa), un grupo fosfato y 4 bases nitrogenadas (adenina, timina, guanina y citosina). FALSO
Falso o verdadero con respecto al ADN: Es una molécula bicatenaria (dos cadenas complementarias), conformada por: una pentosa (desoxirribosa), un grupo fosfato y 4 bases nitrogenadas (adenina, timina, guanina y citosina). VERDADERO
¿Cuál es el tipo de unión que permite la formación de una cadena de nucleótidos? La unión que permite la formación de una cadena de nucleótidos es la del tipo fosfodiéster, es decir, la unión que se da a través del grupo fosfato.
¿Cuáles son las funciones biológicas de los nucleótidos?, elegir la opción que corresponda Actúan como: fuente de energía, mensajeros intracelulares, participan en sistema de óxido-reducción, intervienen en el metabolismo de glúcidos y lípidos.
¿Por qué en el ADN el azúcar que lo conforma en el carbono 2 no tiene el hidróxilo? Porque sin ese hidróxilo en el carbono 2, el ADN es más estable a la hidrólisis.
Que diferencia a los nucleótidos? Las bases nitrogenadas
Como se llama la porción de ADN que se transcribe? GEN
Cuando el ADN se transcribe, que tipos de ARN puede copiar? ARNm, ARNr, ARNt, ARNpn, ARNpc m=mensajero, r=ribosomal, t=transferencia, pn=pequeños nucleares, pc=pequeños citoplasmáticos
Donde ocurre la maduración del ARN en los procariontes? Los procariontes no tienen el proceso de maduración
Cuando el ADN procarionte se transcribe, que tipos de ARN puede copiar? ARNm, ARNr, ARNt, m=mensajero, r=ribosomal, t=transferencia
Cuantas veces en su vida se duplica una célula Una sola vez
En la fase S se duplica el ADN, que otra estructura se duplica en esta fase Las histonas
Para que las dos cadenas del ADN se separen que uniones se tienen que cortar? Uniones puentes de hidrógeno
En fase G1 cuantas cromatides tienen los cromosomas? 1
Con cuantas cromatides entran los cromosomas a la mitosis? Con dos
La cadena de ADN es: Conservativa, semiconservativa, desconservativa? y que significa? Es semiconservativa y significa que cada célula hija en su ADN conserva una cadena original y una copia
Que significa la premisa, el ADN es secuencial... Significa que se duplica una sola vez en su vida
Que significa la premisa, la duplicación del ADN es asincrónica... Significa que no se duplica todo al mismo tiempo, se va duplicando de a pedazos
Que significa la premisa, la duplicación del ADN es bidireccional... Hay varios origenes de duplicación y se da por pares, cada unidad del par va en dirección contraria uno hacia arriba y el otro haci abajo
Que es una señal en el ADN? El ADN es un polímero de nucleótidos, por lo tanto, la señal del ADN es una pequeña porción de nucleótidos
Que significa la premisa, la duplicación del ADN es multifocal... En un cromosoma hay muchos origenes de duplicación
Cuantos orígenes de duplicación existe en el cromosoma bacteriano? Un solo origen de duplicación
Que científicos comprueban la teoría semiconservativa de la duplicación del ADN y en que consiste esta teoría? El experimento de Meselson-Stahl fue un experimento realizado en 1957l en el que se demostró que la replicación de ADN era semiconservadora. Es aquella en que la cadena de dos filamentos en hélice del ADN se replica de forma tal que cada una de las dos cadenas de ADN formadas consisten en un filamento proveniente de la hélice original y un filamento nuevo sintetizado.
Que nombres reciben los diferentes modelos de duplicación del ADN en cuanto a la conservación de sus cadenas en las células hijas?
Que moléculas son los origenes de duplicación del ADN? Son una secuencia especial de nucleótidos
Las enzimas que participan en ambos sentidos de la duplicación son idénticas o diferentes? Son idénticas
Que nombre recibe cada mitad de la burbuja de replicación del ADN?
Que función tiene la helicasa en el proceso de duplicación del ADN?
Cuando la Helicasa separa las cadenas del ADN, se generan enrrollamientos o torsiones en el extremo de la horquilla, que molécula elimina estos enrrollamientos?
Que proteínas impiden la unión de las cadenas del ADN después de ser separadas por la HELICASA
Cual es la Enzima capaz de fabricar ADN nuevo?
En que dirección la ADN polimerasa lee la hebra molde para generar una nueva hebra?
En que dirección, la ADN polimerasa sintetiza la nueva hebra del ADN?
A través de que unión se unen los nucleótidos de una hebra de ADN?
En el ADN, cuales son los pares de bases nitrogenadas que se forman y cuantos puentes de H. unen a estos pares?
Que nombre reciben los fósforos liberados de los nucleótidos antes de entrar al proceso de duplicación del ADN? Pirofosfato
La siguiente premisa es Falsa o Verdadera? La ADN polimerasa no puede iniciar el proceso sintesis de duplicación de la nueva hebra de ADN Verdadero. La ADN Polimerasa necesita un pedazo de ácido nucleico para continuar con el proceso
Que nombre recibe la enzima que fabrica un pedazo de ARN para que la ADN polimerasa se pueda pegar e iniciar síntesis de AN?
Como se llama el pedazo de ARN sintetizado por la PRIMASA? CEBADOR O PRIMER
Cuantos tipos de ADN polimerasas intervienen en la síntesis de ADN ADN polimerasa I ADN polimerasa II ADN polimerasa III
Que función tiene la ADN polimerasa I ?
Que función tiene la ADN polimerasa II ?
Que función tiene la ADN polimerasa III ?
¿Cuál es el primer paso en el proceso de replicación del ADN? a) Unión de la enzima a la hebra de ADN b) Inserción de nucleótidos en la nueva cadena de ADN c) Apertura de las las hebras de la alfa-hélice d) Compactación del ADN c) Apertura de las las hebras de la alfa-hélice
Cómo se denomina a la enzima de la repliación del ADN? ADN polimerasa
¿Qué es la HORQUILLA DE REPLICACIÓN? Es una porción de ADN en la cual las hebras se encuentran separadas y el ADN se puede replicar
La secuencia de ADN en la hebra 1 (5´-3´) que se va a replicarse es: ATTCGGCATAACGGACTTACG ¿Cuál será la secuencia de ADN replicada de esa cadena? TAAGCCGTATTGCCTGAATGC
¿Quién incorpora los nucleótidos a la cadena que se va replicado? a) La ADN polimerasa II b) La ADN polimerasa III c) La exonucleasa d) La ADN polimerasa I b) La ADN polimerasa III
Completa la siguiente frase: La repliación del ADN es... a) 100% conservativa b) No conservativa c) Unidireccional d) Semiconservativa d) Semiconservativa
¿Cuál de los siguientes elementos NO son parte de la replicación del ADN? Uracilo, ADN polimerasa, Citocina, helicasa Uracilo
¿Cómo se denominan los fragmentos de ADN replicados en la cadena discontinua (3'-5')? Okasaky
La demostración, de que el ADN celular se replica por un mecanismo semiconservativo, fue realizada por dos biólogos americanos, Matthew Meselson y Franklin Stahl utilizando cultivos bacterianos de Escherichia coli. Esto fue demostrado en el año 1957
¿Qué es un cariotipo? Es la constitución cromosómica de un individuo. Los cariotipos se pueden informar presentando todos los pares cromosómicos ordenados de acuerdo a su tamaño, actualmente se pueden hacer con analizadores automáticos en cualquier etapa de división celular.
Show full summary Hide full summary

Similar

Biología Celular
maya velasquez
Niveles de Organizaciòn
Sofi :3
PASAPALABRA  sobre  ANATOMÍA
JL Cadenas
Práctica de Biología para la Prepa 1
Raúl Fox
Examen de Repaso de Biología
Diego Santos
1. LA CÉLULA
Vivi Riquero
TEST MICROBIOLOGÍA e INMUNOLOGÍA
VICTOR MANUEL VITORIA RUIZ
Biología para la PSU
Lolo Reyes
Práctica de Biología para la Prepa 2
Raúl Fox
Aparato CIRCULATORIO - De Mapa Mental
JL Cadenas
mitosis y meiosis
juan perez