< >
Join now to discover more
or create your own Quizzes
GoConqr is a social learning network with free tools, resources, courses and groups.
already a member? Log in

Prova Professor Seduc/CE 2009 - Cespe

Question 1 of 35

Medal-premium 1

As células são consideradas unidades morfofuncionais dos seres vivos. Acerca de elementos caracterizadores das células vivas, assinale a opção correta

Select one of the following:

  • O citoplasma das células procariontes está dividido em um extenso sistema de membranas que dão origem a vesículas e novas membranas

  • A mitocôndria é uma organela citoplasmática presente em todas as células vivas

  • O citoesqueleto presente nas células eucariontes responde pelos movimentos e pelas formas da célula

  • Os seres com células procariontes possuem núcleo individualizado

Question 2 of 35

Medal-premium 1

As organelas presentes no citoplasma dos seres vivos desempenham funções específicas. Com relação a esses componentes celulares, julgue os itens a seguir:
I O complexo de Golgi é formado por um sistema de vesículas esféricas de mesmo tamanho e do qual se originam vesículas achatadas.
II As mitocôndrias são estruturas que produzem energia a partir de moléculas de ácidos graxos e glicose, substâncias retiradas dos alimentos.
III O método de coloração ácido-base é adequado para a visualização dos nucléolos, em qualquer fase da divisão celular.
IV Ao microscópio eletrônico, o centríolo apresenta-se como um conjunto de 27 microtúbulos dispostos em 9 feixes, cada um com 3 microtúbulos paralelos, presos entre si.
Estão certos apenas os itens

Select one of the following:

  • I e II

  • I e III

  • II e IV

  • III e IV

Question 3 of 35

Medal-premium 1

Os processos energéticos realizados pelas células fornecem os meios necessários para que essas estruturas realizem suas atividades. No que concerne a esse tema, assinale a opção correta.

Select one of the following:

  • Os depósitos de energia na forma de glicogênio e gordura neutra presentes nas células estão concentrados e estáveis, sendo facilmente utilizáveis por essas estruturas para realizar suas atividades

  • Os citocromos formam uma cadeia enzimática envolvida no transporte de elétrons de alta e de baixa energia, que liberam e absorvem energia simultaneamente

  • O ciclo de ácido cítrico envolve inúmeras reações enzimáticas. Na composição das enzimas envolvidas nesse processo, estão vitaminas como a biotina, a B1 e a B2, e muitas coenzimas

  • A acetilcoenzima A é produzida a partir da descarboxilação do piruvato e da combinação do acetato com a coenzima

Question 4 of 35

Medal-premium 1

Entre as atividades realizadas pelas células, a digestão constitui um mecanismo que envolve a participação de estruturas, movimentos celulares e de inúmeros compostos em uma engrenagem bem integrada. Acerca do processo de digestão celular, assinale a opção correta

Select one of the following:

  • A fagocitose é um processo de englobamento de partículas sólidas e líquidas, facilmente visualizada em microscópio de contraste de fase, desde que o substrato seja submetido a tratamento com corantes básicos

  • A micropinocitose é um processo sempre seletivo, assim como a fagocitose. Como exemplo da propriedade de seletividade, têm-se as células precursoras de hemácias incorporadoras de transferrina, em cuja membrana celular existe glicocálix

  • Os fagossomos, estruturas celulares responsáveis pela digestão celular, possuem enzimas hidrolíticas com intensa atividade em qualquer pH

  • Nos neurônios e no músculo cardíaco, os corpúsculos residuais não são eliminados e, por se agregarem, formam grânulos de lipofuscina, visíveis ao microscópio óptico

Question 5 of 35

Medal-premium 1

As células formam novas células por meio de mecanismo complexo de alterações morfológicas de natureza cíclica. Com relação ao ciclo de divisão celular, assinale a opção correta

Select one of the following:

  • O ciclo celular compreende etapas bem definidas. Em comum, as etapas são caracterizadas por mudanças morfológicas nucleares

  • A fase S caracteriza-se pela síntese de RNA e proteínas, além de ter duração variável

  • Na prófase da mitose, ocorre uma condensação gradual da cromatina interfásica, formando os cromossomos

  • A metáfase compreende a migração polar dos cromossomos com o auxílio de microtúbulos

Question 6 of 35

Medal-premium 1

Para estudar as células, métodos de investigação e técnicas citoquímicas podem ser empregados. Acerca desse tema, assinale a opção correta

Select one of the following:

  • A fixação é uma etapa inicial necessária à obtenção de preparados citológicos permanentes

  • Os corantes são empregados para aumentar o contraste na microscopia. O formol e o ácido glutárico são exemplos de fixadores, que se combinam com grupamentos carboxila dos compostos carbônicos

  • Na microscopia eletrônica, os fixadores devem causar modificações mínimas, como o composto denominado glutaraldeído. Contudo, o tetróxido de ósmio, que também é fixador, para reduzir as alterações celulares, precisa ser associado ao aldeído glutárico

  • Uma ameba de água doce, para ser corretamente fixada, deve ser submetida à substância fixadora com pressão osmótica igual à empregada para fixar célula de mamífero

Question 7 of 35

Medal-premium 1

O microscópio óptico possui uma parte mecânica que serve de apoio ou suporte para a parte óptica, formado por um sistema integrado de lentes. No que se refere ao funcionamento do microscópio óptico, assinale a opção correta.

Select one of the following:

  • O sistema de lentes, que funcionam de modo integrado, não precisa de maiores cuidados em sua montagem. Por exemplo, a objetiva ajusta-se ao condensador, independentemente da qualidade e resolução

  • O limite de resolução é uma propriedade do microscópio óptico relacionada à capacidade de separar detalhes. Assim, depende essencialmente da ocular

  • A fórmula empregada no cálculo do limite de resolução revela que esse limite é diretamente proporcional à abertura numérica

  • Uma diferença percebida na microscopia de polarização diz respeito às estruturas anisotrópicas e isotrópicas. As anisotrópicas são também denominadas birrefringentes, pois apresentam dois índices de refração diferentes, conforme a incidência da luz

Question 8 of 35

Medal-premium 1

O microscópio eletrônico emprega feixes de elétrons acelerados por diferença de potencial. Os componentes de tal instrumento assemelham-se esquematicamente ao microscópio óptico. Acerca desse assunto, assinale a opção correta

Select one of the following:

  • No microscópio eletrônico, os elétrons são produzidos por aquecimento de um filamento de tungstênio no vácuo

  • No estudo de vírus e bactérias, utilizando microscopia eletrônica, são usados exclusivamente os corantes denominados positivos, que se caracterizam pelo emprego de substâncias impermeáveis aos elétrons

  • A microscopia de varredura caracteriza-se pela impossibilidade de produzir modificação no trajeto do feixe de elétrons

  • A técnica de coloração positiva permite a visualização de bacteriófagos, graças à formação de um halo claro, que se forma como resultado de depósito de sais de uranila, em volta dessas estruturas

Question 9 of 35

Medal-premium 1

As biomoléculas são constituídas basicamente de hidrogênio, carbono, oxigênio e nitrogênio, que se arranjam e se reordenam formando inúmeros compostos com pesos específicos e agrupamentos químicos que conferem a eles propriedades igualmente significativas para o funcionamento celular. Acerca dos compostos macromoleculares, assinale a opção correta

Select one of the following:

  • Entre os biopolímeros, são encontrados os monômeros semelhantes denominados homopolímeros e os heteropolímeros. O glicogênio é um composto heteropolimérico, enquanto os ácidos nucleicos são exemplos de homopolímeros

  • Em geral, as enzimas são compostos proteicos. Mas existem certos catalisadores nucleicos, sob o controle do DNA, que têm composição dissacarídica

  • O polimorfismo proteico explica-se pela composição de monômeros, que são cerca de 20 tipos

  • As forças de estabilização envolvidas na estabilidade da cadeia polipeptídica são a ligação peptídica, a interação hidrofóbica, as pontes de hidrogênio e as ligações dissulfeto

Question 10 of 35

Medal-premium 1

Com relação ao sistema locomotor, assinale a opção correta

Select one of the following:

  • Se o professor quiser demonstrar o funcionamento do par de músculos flexor/extensor, pode fazê-lo da seguinte forma: um aluno tenta erguer uma mesa, enquanto outro aluno segura o braço do primeiro e, apalpando-o, observa o músculo em extensão

  • Ligamento é um tecido conjuntivo que mantém os ossos unidos nas articulações

  • Os músculos lisos são aqueles envolvidos nos movimentos voluntários, ainda que não visíveis aos olhos humanos

  • Exercícios de musculação praticados em academia geralmente aumentam a extensão dos músculos do corpo humano

Question 11 of 35

Medal-premium 1

No jogo de sedução apresentado no filme norte-americano Jogando com prazer, produção de Ashton Kutcher, percebe-se o uso de inúmeras estratégias por parte do sedutor para envolver mulheres e conquistá-las. No organismo dos envolvidos, tanto sedutor como seduzidas, inúmeras transformações e reações estão ocorrendo; no sistema circulatório, podem ser observadas
algumas das reações ao jogo de sedução. No que se refere ao processo integrado que ocorre no corpo humano em um jogo de sedução, assinale a opção correta

Select one of the following:

  • A pessoa seduzida, ao inspirar mais pausadamente, permite que seu sangue transporte mais gás carbônico das células para os pulmões

  • Ao receber o estímulo externo, a pessoa seduzida elimina compostos químicos que são conduzidos pelo sangue às células, desencadeando inúmeras reações, do rubor facial ao aceleramento do batimento cardíaco. A substância química responsável por tais reações é a acetilcolina

  • O ritmo cardíaco acelerado aumenta também o ritmo respiratório. O trajeto da pequena circulação compreende o sangue pobre em oxigênio sair do coração pela veia pulmonar, alcançar os capilares pulmonares e retornar ao coração pelas artérias pulmonares, agora rico em oxigênio

  • Ao ser seduzida, a pessoa pode ter um aumento da pressão do sangue bombeado pelo coração sobre a parede dos vasos sanguíneos. Uma hipertensão também pode decorrer de distúrbios como a aterosclerose, que, por sua vez, pode ser responsável por um ataque cardíaco ou um acidente vascular cerebral

Question 12 of 35

Medal-premium 1

Acerca do sistema esquelético, assinale a opção correta

Select one of the following:

  • A espinha dorsal humana é constituída de cerca de 33 ossos distribuídos em vértebras cervicais, torácicas, lombares, sacro e cóccix

  • O esqueleto de um embrião, no início da gestação, apresenta, em sua composição, sais de cálcio

  • A calcificação dos ossos é um processo que se completa na puberdade

  • O impacto dos exercícios aeróbios estimulados na academia é percebido nas articulações, pois o sistema esquelético, por ser endurecido, não sofre qualquer dano

Question 13 of 35

Medal-premium 1

A respeito do sistema nervoso humano, assinale a opção correta

Select one of the following:

  • O comprimento e a espessura das células nervosas humanas são constantes

  • Um neurônio típico é formado de dendritos, axônio e corpo celular

  • A bainha de mielina é uma bainha que envolve o axônio internamente e é composta de neurilema

  • O nódulo de Ranvier está presente em toda a extensão da célula nervosa

Question 14 of 35

Medal-premium 1

No estudo da hereditariedade humana, a molécula de DNA exerce papel fundamental na compreensão dos mecanismos de transmissão de certos caracteres e mesmo doenças. Assinale a opção correta com relação a genes e código genético.

Select one of the following:

  • A atividade gênica tem grande parte de sua regulação ocorrendo ao nível da tradução

  • As sequências denominadas palíndromos caracterizam-se pelo fato de o corte com Eco R1 ser simétrico

  • Os PCFR são marcadores genéticos empregados no diagnóstico pré-natal e também servem para o mapeamento do genoma humano

  • Se uma fita de DNA tem a seguinte sequência de bases CATGTAGAATGCGGGCTT, então ela tem a fita de RNAm como CAUGUAGAAUGCGGGCUUCUU

Question 15 of 35

Medal-premium 1

De acordo com o padrão mendeliano, o heredograma para as doenças autossômicas dominantes e recessivas apresenta características peculiares. A esse respeito, julgue os itens a seguir.
I Em uma herança autossômica dominante, o heredograma padrão apresenta cada indivíduo afetado com um genitor afetado até o ponto nos ancestrais quando o gene mutante surgiu em decorrência de mutação nova.
II Em uma herança autossômica recessiva, os parentes não afetados de pessoas afetadas não terão prole afetada.
III No padrão de heredograma de uma herança autossômica dominante, os irmãos de uma criança afetada com genitores normais têm uma chance em quatro de serem afetados, independentemente do sexo.
IV O padrão de heredograma para herança autossômica recessiva esclarece que, em prole pequena, a maioria dos casos é esporádica.
Estão certos apenas os itens

Select one of the following:

  • I e II

  • I e IV

  • II e III

  • III e IV

Question 16 of 35

Medal-premium 1

Assinale a opção correta acerca de genética humana.

Select one of the following:

  • A fotomicrografia de um cromossomo humano na metáfase demonstra que existem dois tipos de cromossomos: os acrocêntricos e os metacêntricos

  • Uma característica morfológica que ajuda na identificação de um cromossomo específico denomina-se demarcação cromossômica.

  • Na fotomicrografia de um cromossomo humano, as bandas largas G e as escuras Q costumam ter coloração positiva

  • Para evidenciar as bandas Q, o método de coloração de Giemsa é o mais adequado.

Question 17 of 35

Medal-premium 1

Com relação à genética das células humanas, assinale a opção correta

Select one of the following:

  • A hibridização é uma técnica de estudo de células
    reprodutoras, que permite realizar estudos esclarecedores do
    mapeamento do genoma humano

  • Clonagem é uma técnica de isolamento de sublinhagens que
    empregam mutações apropriadas e técnicas de seleção

  • Mapeamento de loci pode ser mais bem obtido pela
    comparação de bandas mutantes entre si

  • Dois marcadores que se segreguem isoladamente em clone
    de híbrido são denominados sintênicos

Question 18 of 35

Medal-premium 1

No que concerne a conceitos mendelianos e genética humana, assinale a opção correta

Select one of the following:

  • Os neoplasmas são manifestações genotípicas de alterações mendelianas

  • O retinoblastoma é doença maligna da retina de ocorrência na infância. É herança autossômica dominante, mas a maioria é esporádica

  • O xeroderma pigmentoso compreende um grupo de condições herdadas de modo dominante, cuja manifestação demonstra alta sensibilidade da pele à luz

  • A radiação e os agentes ambientais responsáveis por quebras cromossômicas não costumam afetar os cromossomos ao ponto de estes produzirem mutações genéticas

Question 19 of 35

Medal-premium 1

Acerca das anomalias cromossômicas, assinale a opção correta

Select one of the following:

  • A síndrome adrenogenital causa pseudo-hermafroditismo na mulher

  • A anomalia XXXXY ocorre em mulheres

  • Paciente com mosaico de Turner apresenta a seguinte linhagem celular: 46, X

  • Não há registro de casos de pseudo-hermafroditismo masculino

Question 20 of 35

Medal-premium 1

Entre os grandes grupos de organismos vivos existentes no planeta, encontram-se seres clorofilados e fotossintetizantes apenas nos grupos de

Select one of the following:

  • bactérias e animais

  • protistas e fungos

  • bactérias, protistas e plantas

  • fungos, animais e plantas

Question 21 of 35

Medal-premium 1

Em relação às categorias taxonômicas do sistema de classificação biológica, assinale a opção correta

Select one of the following:

  • Canis familiaris, Canis e Mamallia estão em ordem crescente de categoria de agrupamento

  • A ectodermia é a principal característica que agrupa os animais na categoria Mamallia

  • Do ponto de vista taxonômico, para que uma coletânea de fotos de golfinhos, morcegos e gambás, possa ser
    corretamente denominada Mamallia, devem se excluir dela as fotos de golfinhos, que pertencem a uma categoria diversa

  • Canis familiaris e Canis lupussão representantes de gêneros diferentes

Question 22 of 35

Medal-premium 1

Os aspectos considerados nas teorias da evolução das espécies
I adaptação ao meio.
II lei do uso e desuso.
III mutação.
IV herança dos caracteres adquiridos.

Lamarck, em sua teoria, considerou apenas os aspectos

Select one of the following:

  • I, II e III

  • I, II e IV

  • I, III e IV

  • II, III e IV

Question 23 of 35

Medal-premium 1

Considerando que uma espécie de planta tenha todos os seus estômatos fechados pela aplicação de um produto químico especialmente desenvolvido para atuar nessa estrutura, assinale a opção correta

Select one of the following:

  • A existência de estômatos nessa planta indica que ela é um espécime das angiospermas

  • Nessa situação, o fechamento dos estômatos reduz a eliminação de gás carbônico, que é o principal produto da fotossíntese

  • O transporte de seiva bruta, na situação em apreço, será prejudicado com o fechamento dos estômatos

  • Com o fechamento dos estômatos, a planta em questão ficará impossibilitada de absorver a luz

Question 24 of 35

Medal-premium 1

À medida que se avança na cadeia alimentar, aumenta, nos
organismos de níveis tróficos mais elevados, a concentração de
determinados compostos químicos, como alguns poluentes,
devido a sua assimilação nos processos de síntese de tecidos ou
gordura. Esse aumento de concentração de poluentes ao longo da
cadeia alimentar é denominado ampliação biológica, que pode
causar danos à saúde de animais e seres humanos. Assinale a
opção correspondente a dois compostos que, por terem suas
concentrações aumentadas ao longo da cadeia alimentar, causam
danos à saúde dos organismos

Select one of the following:

  • pesticidas e gás metano

  • gás metano e gás carbônico

  • inseticidas e mercúrio

  • mercúrio e gás metano

Question 25 of 35

Medal-premium 1

No combate às larvas de Aedes aegypti (mosquitos transmissores da dengue), foi utilizado, com eficiência, um pequeno sapo que consome apenas larvas de insetos. A utilização do sapo, em um programa governamental de controle da dengue, foi bem sucedida em regiões infestadas pelo Aedes aegypti onde era grande a incidência da doença. A interação interespecífica do sapo em relação às larvas deAedes aegypti é um exemplo de

Select one of the following:

  • mutualismo

  • comensalismo

  • parasitismo

  • predatismo

Question 26 of 35

Medal-premium 1

Em 2009, comemoram-se os 150 anos da publicação da obra A
Origem das Espécies, de Charles Darwin. O principal ponto da
teoria evolutiva de Darwin foi

Select one of the following:

  • a determinação da imutabilidade das espécies

  • a seleção dos indivíduos que possuem variações que mais bem se adaptam ao meio ambiente

  • o estabelecimento da lei de uso e desuso

  • a diminuição da variabilidade genética dentro de uma população em decorrência do processo migratório

Question 27 of 35

Medal-premium 1

Julgue os itens abaixo, relativos ao bioma cerrado.
I Esse bioma concentra-se e tem sua maior distribuição na parte central do Brasil.
II O maior índice pluviométrico no território brasileiro ocorre nas regiões desse bioma.
III O lobo guará e o tamanduá bandeira são exemplos de espécies que ocorrem no bioma cerrado.
IV O cerrado está entre os ecossistemas brasileiros menos diversos e, portanto, a sua taxa de desmatamento não interfere na biodiversidade nacional.
Estão certos apenas os itens:

Select one of the following:

  • I e II

  • I e III

  • II e III

  • III e IV

Question 28 of 35

Medal-premium 1

A quantidade de pombos vem crescendo nas grandes cidades ao longo dos anos. Os principais fatores que contribuem para o crescimento populacional dessa espécie incluem

Select one of the following:

  • a alta disponibilidade de alimento e a falta de ambiente natural para reprodução

  • a ausência de predadores naturais e a dieta altamente especializada

  • a dieta altamente especializada e a falta de ambiente natural para reprodução

  • a alta disponibilidade de alimento e a disponibilidade de ambiente para reprodução

Question 29 of 35

Medal-premium 1

Os agricultores costumam fazer rodízio de culturas, plantando cereais (arroz, trigo, milho) e, em seguida, leguminosas (feijão), que enriquecem o solo. Esse procedimento justifica-se porque algumas espécies de leguminosas

Select one of the following:

  • transformam o nitrogênio gasoso da atmosfera em nitritos

  • fixam o nitrogênio existente na atmosfera, utilizando-o diretamente na síntese de aminoácidos

  • possuem, em suas raízes, organismos simbióticos que fixam o nitrogênio atmosférico em nitrato

  • possuem, em suas raízes, fungos capazes de converter nitrogênio atmosférico em amônia

Question 30 of 35

Medal-premium 1

O reino Plantae, é um dos principais grupos de organismos vivos existentes na Terra, com cerca de 350.000 espécies conhecidas, incluindo uma grande variedade de ervas, árvores, arbustos e algas. As primeiras formas de vida vegetal, as algas, habitavam o ambiente aquático. Ao longo do processo evolutivo, surgiram vegetais como os musgos, as samambaias, as plantas vasculares com floema e xilema e plantas com flores e frutos. Na evolução
dos vegetais, os gametas

Select one of the following:

  • tornaram-se cada vez menos atrativos para polinizadores

  • tornaram-se cada vez mais atrativos para polinizadores

  • mantiveram-se morfologicamente iguais em todos os grupos

  • permaneceram dependentes de água, para transporte e fecundação, em todos os grupos

Question 31 of 35

Medal-premium 1

Pesquisadores descobriram, no deserto do Saara, fósseis de animais com idade estimada em 5 milhões de anos. Esses animais viveram na Terra na época

Select one of the following:

  • dos dinossauros

  • dos primeiros hominídeos

  • em que ocorreu o Big-Bang

  • em que a América do Sul estava fisicamente unida com o continente africano

Question 32 of 35

Medal-premium 1

Julgue os itens subsequentes, relativos às teorias da origem da
vida no planeta Terra.
I A teoria que admite a origem de um ser vivo somente a partir de outro é denominada biogênese.
II A principal característica dos seres vivos primitivos é a ausência de carbono na composição de sua estrutura.
III É mais provável que os primeiros seres vivos tenham sido autotróficos.
Assinale a opção correta

Select one of the following:

  • Apenas o item I está certo

  • Apenas o item II está certo

  • Apenas o item III está certo

  • Todos os itens estão certos

Question 33 of 35

Medal-premium 1

Considerado por muitos o único bioma exclusivamente brasileiro; ocupa uma área em torno de 850.000 de km², cerca de 10% do território nacional, predominantemente na parte nordeste do país; apresenta vegetação típica de regiões semiáridas, com perda de folhagem durante a estação seca. Quanto à flora, foram registradas cerca de 1.000 espécies, entre elas o murici e a
aroeira. Em relação à fauna de vertebrados, foram identificadas
cerca de 876 espécies, entre elas a asa branca e o preá.
O texto acima refere-se ao bioma

Select one of the following:

  • mata Atlântica

  • cerrado

  • amazônia

  • caatinga

Question 34 of 35

Medal-premium 1

Embora o peixe-boi possua poucos predadores naturais (tubarões e jacarés), as duas espécies encontradas no Brasil, o peixe-boi marinho (Trichechus manatus) e o peixe-boi da Amazônia (Trichechus inunguis), constam da lista de espécies ameaçadas como vulneráveis à extinção. Assinale a opção correspondente a
dois fatores que colaboram para a situação de vulnerabilidade dessas duas espécies de peixe-boi

Select one of the following:

  • taxa reprodutiva elevada e ampla ocorrência nos diversos ecossistemas marinhos

  • alimentação diversificada e ampla distribuição ao longo dos ecossistemas marinhos

  • alimentação diversificada e taxa reprodutiva baixa

  • taxa reprodutiva baixa e caça predatória

Question 35 of 35

Medal-premium 1

O Brasil tem uma área de 8,5 milhões de km², ocupando quase a metade da América do Sul. Essa área possui várias zonas climáticas, que incluem o trópico úmido, no Norte, o semiárido, no Nordeste e áreas temperadas, no Sul. As diferenças climáticas contribuem para as diferenças ecológicas, formando zonas
biogeográficas distintas, chamadas biomas, com alta diversidade.
Nesse sentido, os fatores responsáveis pela perda de biodiversidade não incluem

Select one of the following:

  • a perda e fragmentação dos habitats

  • a introdução de espécies e doenças exóticas

  • a exploração excessiva de espécies de plantas e animais

  • os mecanismos de especiação


Prova Professor Seduc/CE 2009 - Cespe

Quiz by , created almost 4 years ago

Biologia Quiz on Prova Professor Seduc/CE 2009 - Cespe, created by renpv on 22/08/2013.

Eye 128
Pin 1
Balloon-left 0
Created by renpv almost 4 years ago