Quiz traducción en proteinas

Juan Rodriguez
Quiz by , created about 3 years ago

Usted cuenta con 16 min para contestar la prueba. Mucho trabajo y dedicación es lo que distingue al triunfador.

268
0
0
Tags No tags specified
Juan Rodriguez
Created by Juan Rodriguez about 3 years ago
Fichas de Microbiología y Biotecnología - Selectividad
LariSa
Examen de Repaso de Biología
Diego Santos
1. LA CÉLULA
Vivi Riquero
AP Psychology Practice Exam
Jacob Simmons
Language Analysis
Connie Theobald
Resumen: La Célula (Bioelementos y biomoléculas)
enriquepunk182
PASAPALABRA  sobre  ANATOMÍA
JL Cadenas
Bioelementos y biomoléculas
Esther Muñoz
Práctica de Biología para la Prepa 1
Raúl Fox
Recursos de Biología para Selectividad
Diego Santos

Question 1

Question
En relación con el código genético, cuál de las siguientes afirmaciones es correcta:
Answer
  • Consta de 65 codones.
  • UAG, UAA, UGA son los codones de terminación o codones de parada.
  • Cada aminoácido tiene tres codones específicos.
  • Está degenerado porque a cada uno de los aminoácidos les corresponde dos o más codones.
  • El código genético es el mismo para todos los organismos sin excepciones.

Question 2

Question
La transcriptasa inversa:
Answer
  • Sintetiza RNA en la dirección 3′—–>5′.
  • Sintetiza RNA leyendo DNA en la dirección 3′—–>5′.
  • Sintetiza RNA leyendo la hebra inversa de otro DNA.
  • Transcribe genes colocando C frente a A y U frente a G.
  • Sintetiza DNA leyendo RNA.

Question 3

Question
El marco de lectura en eucariotas, tiene:
Answer
  • Un único sitio de inicio en el codón GGG que codifica para glicina.
  • Varios sitios de inicio dependiendo de donde empieza a leer el ribosoma.
  • Un único sitio de inicio que es donde está un promotor.
  • Un único sitio de inicio que está en el extremo 5’ del ARNm cerca del AUG.

Question 4

Question
Un ARNm monocistrónico tiene:
Answer
  • Secuencias codificantes y no codificantes alternadas.
  • información para la síntesis de distintos polipéptidos.
  • un único codón de inicio de la traducción.
  • varios codones de inicio de la traducción.

Question 5

Question
Los ARNm eucariotas se diferencian de los ARNm procariotas en que los primeros:
Answer
  • Son monocistrónicos y su traducción es pos- transcripcional.
  • Son policistrónicos y poseen intrones.
  • Son monocistrónicos y su traducción es co- transcripcional.
  • Son policistrónicos y sufren camping en el extremo 5'.

Question 6

Question
Esta es la cadena inicial de ADN: ACGTAC ¿Cómo quedaría la cadena complementaria de ADN?
Answer
  • TGCAUG
  • TGCATG
  • TCGATG
  • ACGTAC

Question 7

Question
¿Cómo se puede producir el proceso de síntesis de proteínas?
Answer
  • ADN,ARN,PROTEINAS, TRANSCRIPCIÓN, TRADUCCIÓN
  • ADN, ARN, PROTEINAS, TRADUCCIÓN, TRANSCRIPCIÓN
  • ADN,ARN,ARNm,ARNt Y PROTEINAS
  • PROTEINAS, ARN,ADN,TRANSCRIPCIÓN Y TRADUCCIÓN

Question 8

Question
En qué se diferencia el RNA del ADN:
Answer
  • son iguales no tienen ninguna diferencia
  • En que el azúcar es la ribosa y la T es convertida en Adenina.
  • En el que el azúcar es la desoxirribosa y la T es convertida en Uracilo.
  • En que el azúcar es la ribosa y la T es convertida en Uracilo.

Question 9

Question
¿Cómo sabe el ribosoma que ha terminado la lectura y síntesis de las proteínas?
Answer
  • Porque se acaban los aminoácidos.
  • Porque no funcionan los ribosomas.
  • Por una secuencia terminal en el ARN mensajero

Question 10

Question
Un mRNAmonocistrónico codifica para varios polipéptidos, teniendo en cuenta varios codones de inicio y terminación permitiendo llevar a cabo la traducción.
Answer
  • True
  • False

Question 11

Question
La metionina permite iniciar el proceso junto con la subunidad AUG en procariotas.
Answer
  • True
  • False

Question 12

Question
Solamente la información contenida entre las señales de inicio [blank_start]AUG[blank_end] y terminación [blank_start]UAA, UAG, UGA[blank_end] de una molécula de [blank_start]ARNm[blank_end] es usada para producir una secuencia de aminoácidos; después de la señal de inicio AUG, el ribosoma lee tres [blank_start]nucleótidos[blank_end] a la vez. Teniendo en cuenta que cada grupo de tres nucleótidos, o [blank_start]codón[blank_end], especifica un aminoácido en particular.
Answer
  • AUG
  • UAA, UAG, UGA
  • ARNm
  • nucleótidos
  • codón

Question 13

Question
El proceso de iniciación consiste en que el codón de inicio AUG tiene como segunda función el incorporar metionina en el interior de la cadena polipeptídica, la cual crecerá guiada por el ARNm, a este se le denomina el enlace polimerizante; allí actúan otras proteínas y los factores de elongación.
Answer
  • True
  • False

Question 14

Question
Un anticodón es la unidad básica de información el cual codifica un aminoácido y este corresponde a la base del código genético que permite traducir la secuencia de ARNm a la secuencia de aminoácidos que constituye la proteína.
Answer
  • True
  • False

Question 15

Question
La oxitocina se encuentra conformada según la secuencia de ADN que aparece a continuación. ¿Cuál será la hebra de ARNm que la codificaría? ADN: 3´ ACA-TGC-TAG-GTT-TTA-ACG-GGC-ATT-CCT 5´
Answer
  • a.5’UUAUGCAAGCCAGCGAUGAGCUAAGCGAAAUAGAGAUUA3'
  • b.5’ AGGAAUGCCCGUUAAAACCUAGCAUGU 3’
  • c.3’ AUG- UCU- AAA- UCG- GAU- CAG- CGG- UGU- CUA- CCG- UGA 5’
  • d. 5'GAU-CGU- GUC-UAU- AUC- CAC- CCG- UUC- UAG 3'