Quiz
Pharm 511
Create a free account to finish this quiz
Save your progress and see your final score.
Already have an account? Sign in
Questions in this quiz (119)
1The three parts of each nucleotide are:
- A Cytosine, ribose, and phosphate
- BNitrogenous base, phosphate, and pentose sugar
- CAmino group, phosphate, and pentose sugar
- D Phosphate, ribose, and nitrogenous base
2For the DNA sequence, 5′-ATCGATCGATCGATCG-3′, which of the following represents the sequence and polarity of the complementary strand?
- A3′-CGATCGATCGATCGAT-5'
- B5′-ATCTATCGATCGATCG-3'
- C 5′-CGATCGATCGATCGAT-3'
- D3′-ATCGATCGATCGATCG-5'
3 Okazaki fragments are:
- A found on the lagging strand
- Bassembled as continuous replication
- Csynthesized by telomerase
- D found on the leading strand
- A found on the lagging strand
4Which of the following statements about DNA replication in E.Coli is correct?
- A
It uses RNA as a template - B It involves discontinuous synthesis in the leading strand
- C It is bidirectional
- DIt proceeds with one replication fork per replicating molecule
- A
5 This enzyme is responsible for copying DNA.
- A Ligase
- B
Primase - CRNase H
- D DNA polymerase
6Given the diagram below, what type of base-pair mutation has occurred?
GCAGTGT------ GCAGTGT
CGTCACA-------CGTUACA- A
Transversion - B Frameshift
- C Insertion
- DTransition
- A
7Which of the following statements about DNA replication in prokaryotes is true?
- A All prokaryotic DNA polymerases are not capable of proofreading
- B It involves continuous DNA synthesis in both strands
- C Does not require topoisomerase
- DHas multiple points of origin
8Which of the following statements about ribonucleotide reductase is true?
- A It catalyzes the addition of pyrophosphate
- BIt contains two kinds of allosteric regulatory sites, one for control of overall activity and another for control of substrate specificity
- C It converts 2’ -deoxyribonucleoside diphosphates into ribonucleoside diphosphates
9The conversion of dUMP to dTMP by thymidylate synthase requires which of the following?
- A N5,N10-methylenetetrahydrofolate
- B Ribonucleotide synthetase
- C Thioredoxin
- DGlutathione
10Lesch Nyhan syndrome is due to the inability to catalyze which of the following reactions?
- A Guanine to GMP
- BAdenine to AMP
- C Thymine to TMP
- DAdenosine to AMP
11The reason the amount of A = T and G = C ("Chargaff's Rule") is because:
- AX-ray diffraction indicated a double-helical pattern in DNA
- B DNA has polarity
- C phosphates alternate with pentose sugars in the DNA backbone
- D purines base-pair with pyrimidines
12Allopurinol can be used to treat gout because of its ability to inhibit which of the following reactions?
- AXanthine to uric acid
- B XMP to GMP
- C AMP to XMP
- D IMP to XMP
13Which of the following statements about nucleotide synthesis is true?
- A De novo synthesis of purines does not require ATP
- B PRPP participates in purine salvage pathways
- CIn purine synthesis, the nitrogenous base is made first, followed by addition of the ribose sugar
- DPRPP is utilized in purine de novo synthesis but not in pyrimidine de novo synthesis
14Which of the following amino acids contribute atoms utilized in purine biosynthesis?
- A Asp, Gly, Gln, Phe
- B Asn, Gly, Gln, Phe
- C Asp, Gly, Gln
- DAsp, Gln, Phe
15One of the end products of pyrimidine catabolism is:
- Ahypoxanthine
- Buric acid
- C Beta-alanine
- Dfumarate
165-flurouracil, an anti-metabolite, is used as an anti-tumor agent by inhibiting the production of which following compounds?
- AdTMP
- B dUMP
- CTMP
- Dxanthine
17Which of the following statements about pyrimidine synthesis is true?
- A Does not require PRPP
- B Is inhibited by ATP
- C Carbamoyl phosphate synthetase II is activated by UDP
- DAspartate and glutamine are required
18In a DNA molecule, the
- Abases are hydrogen bonded to one another
- Bphosphates are hydrogen bonded to one another
- Csugars are composed of 8 carbon rings
- Dbases are covalently bonded to one another
19Doubled-stranded DNA consists of two antiparallel strands, meaning that one strand is oriented in the 5’ to 3’ direction, while the other is oriented in the 3’ to 5’ direction.
- ATrue
- BFalse
20A eukaryotic chromosome is made up of:
- A Histones and nucleic acid
- BDNA and RNA only
- CLoops of naked DNA
- D DNA only
21Three types of RNA involved in protein synthesis, comprising the structural and functional core, serving as a template for translation, and transporting amino acid, respectively, are:
- A rRNA, tRNA, mRNA
- BtRNA, mRNA, rRNA
- CrRNA, mRNA ,tRNA
- D mRNA, tRNA, rRNA
22DNA replication results in two identical daughter molecules each consisting of one old (original) strand and one newly-synthesized strand
- ATrue
- BFalse
23Identify the DNA template (1) and the coding (2) strand for the following mRNA sequence:
5’-AUG CGU AAG UCA UAA-3’- A (1) 3’-UAC GCA UUC AGU AUU-5’, (2) 5’-AUG CGU AAG UCA UAA-3’
- B(1) 3’-ATG CGT AAG TCA TAA -5’, (2) 5’-TAC GCA TTC AGT ATT -3’
- C (1) 3’-TAC GCA TTC AGT ATT-5’, (2) 5’-ATG CGT AAG TCA TAA-3’
- D (1) 5’-TAC GCA TTC AGT ATT-3’, (2) 3’-ATG CGT AAG TCA TAA-5’
24Which of the following processes is involved in the termination of transcription in prokaryotic cells?
- ABinding of the s factor to the promoter region of the DNA template
- BBinding of the mRNA molecule to a release factor (RF-1 or RF-2)
- C Binding of the helicase Rho to the mRNA molecule
- DAddition of a poly(A) tail to the 3’ end of the mRNA molecule
25Which of the following events occurs during the initiation of translation in prokaryotic cells?
- ABinding of the initiator tRNA with a formylated methionine to the start codon in the mRNA molecule with the help of initiation factor IF-2
- BBinding of the Shine-Delgarno sequence to the A-site of the small ribosomal subunit
- CDelivery of an aminoacyl-tRNA to the A-site of the ribosome with the help of initiation factor IF-2
- DBinding of the initiation factor IF-1 to the P-site of the small ribosomal subunit
26After the aminoacylation reaction is completed we say that the tRNA is charged because:
- AThe tRNA will contain a branch point
- BThe OH group at the 3’ end of the acceptor stem has been capped
- CAn amino acid is attached to the acceptor stem of the tRNA molecule
- D The 3’ end of the tRNA molecule has received a poly(A) tail
27Translation termination requires that the ______.
- A Formation of a hairpin in the mRNA structure
- B GTP-bound release factors 1 OR 2 (RF-1 or RF-2) recognizes one of the Stop codons
- CGTP-bound initiation factor IF-2 recognizes one of the Stop codons
- DGTP-bound elongation factor EF-Tu recognizes one of the Stop codons
28What is the role of the s factor during transcription in prokaryotes?
- AThe s factor binds to the helicase Rho in order to terminate transcription
- B The s factor promotes the transition from initiation to elongation by binding to the C-terminal domain (CTD) in the RNA polymerase
- CThe s factor is responsible for proofreading during synthesis of the mRNA molecule
- DThe s factor recognizes the promoter in the template strand
29Which of the following applies ONLY to transcription in prokaryotic but not eukaryotic cells?
- ARNA polymerase II is responsible for the synthesis of the mRNA molecule
- BInitiation of RNA synthesis requires the identification of the promoter by general transcription factors
- CTranscription is regulated by the presence of distal regulatory elements in the template strand
- DTranscription of functionally related genes is organized in operons
30Tetracycline binds to the small ribosomal subunit and blocks protein synthesis. Identify the mechanisms by which tetracycline blocks protein synthesis.
- A Tetracycline blocks the proofreading activity of the ribosome resulting in codon-anticodon mispairing
- B Tetracycline binds to the P-site of the ribosome preventing the initiation of translation
- C Tetracycline prevents the binding of aminoacyl-tRNAs to the ribosomal A-site. This inhibits elongation of the polypeptide chain
- DTetracycline blocks the transpectidation reaction by which the free amino group of the aminoacyl-tRNA (in the A-site) attacks the ester bond of the peptidyl-tRNA (in the P-site)
31During the aminoacylation reaction, the correct amino acid is covalently attached to a tRNA by the corresponding ________.
- Arelease factor 3 (RF-3)
- Baminoacyl-tRNA synthetase (AARS)
- C initiation factor
- Delongation factor
32Which of the following statements can best describe the function of the Shine-Dalgarno sequence found in the mRNA of prokaryotes?
- A The Shine-Dalgarno is a nucleotide sequence responsible for the Rho-independent termination of transcription
- B The Shine-Dalgarno is a nucleotide sequence that facilitates the export of the mRNA molecule from the nucleus
- CThe Shine-Dalgarno is a three nucleotide sequence used as the start codon for protein synthesis
- DThe Shine-Dalgarno is a nucleotide sequence that interacts with the small ribosomal subunit in order to align the start codon at the start of translation
33What is the functional role of capping the 5’ end and adding a poly(A) tail to the 3’ end of the mRNA molecule?
- A These two modifications are used to terminate mRNA synthesis
- B These two modifications prevent interaction of the mRNA molecule with the endonuclease Dicer
- C These two modifications facilitate the interaction with the spliceosome in order to remove all introns from the mRNA sequence
- DThese two modifications protect the mRNA molecule from degradation by exonucleases
34The mRNA of eukaryotic cells undergoes splicing __________
- ABecause transcription and translation occur in different compartments of the cell
- BIn order to facilitate the recognition of the mRNA sequence during protein synthesis
- CBecause protein-coding sequences (or exons) are separated by long non-coding regions (or introns)
- D In order to protect the mRNA molecule from the attack of exonuclease
35Which of following best describes the two-step process for adding amino acids to tRNAs?
AA = amino acid, Pi = phosphate, PPi = pyrophosphate- A tRNA + ATP → tRNA-AMP + PPi; tRNA-AMP + AA → AA-tRNA + AMP
- B AA + GTP → AA-GMP + PPi; AA-GMP + tRNA → AA-tRNA + GM
- C AA + ATP → AA-P + ADP; AA-P + tRNA → AA-tRNA + Pi
- D AA + ATP → AA-AMP + PPi; AA-AMP + tRNA → AA-tRNA + AMP
36Which is TRUE about antibody (Ab)?
- A Ab/antigen complex can be recognized and destroyed by erythrocytes
- BAb is produced in response to self carbohydrate groups
- C Ab is produced from B lymphocytes
- D Ab is double-stranded DNA
37The target of anti-sense oligonucleotide is ________ in cytoplasm.
- A all of the above
- BmRNA
- CProtein
- DDNA
38A functional plasmid requires a replication origin
- ATrue
- BFalse
39During the production of mAb, culture is grown in HAT medium. Myeloma cells that DID NOT fuse or that fuse only with other myeloma cells will ____ because they are ____.
- ADie; HGPRT+
- Blive; immortal
- CDie; HGPRT-
- D Live; HGPRT-
40Heat-shock transformation introduces plasmid into _________
- A cultured cell
- B tissue
- C egg
- Dbacteria
41Hybridomas are produced by fusing myeloma cells with T cells
- ATrue
- BFalse
42Which of the following is a valid restriction enzyme recognition sequence?
- ACATGTGAC
- BCATFTT
- CGGCC
- DATGC
43Which is FALSE about Gefitinib?
- AGefitinib binds to ATP-binding site of the enzyme
- BGefitinib is a selective EGFR tyrosine kinase (TK) inhibitor
- C Patients with activating mutations in the TK domain of EGFR respond poorly to gefitinib
- DEffective to treat non-small-cell lung cancer
44Which is FALSE about Methotrexate (MTX)?
- AMTX inhibits dihydrofolate reductase (DHFR)
- BMTX enhances the folic acid metabolism
- C MTX polyglutamates can inhibit thymidylate synthase (TYMS)
- DMTX is used for treatment of cancer and autoimmune diseases
45Which is TRUE about MTX polyglutamates?
- A Usually 500-700 glutamate residues are added
- B MTX polyglutamates are selectively retained inside the cancer cells
- C this process is terminated by the enzyme folylpolyglutamate synthase (FPGS)
- DIt is formed outside the cells
4649. Slow acetylator activity causes INH
- ACYP2D6
- B NAT2
- CUGT1A1
47Deficient phenotype increases risk of toxicity of antidepressants or antipsychotics
- AUGT1A1
- BCYP2D6
- CNAT2
48Reduced activity linked to high levels of active metabolite of irinotecan
- ANAT2
- BB. CYP2D6
- CUGT1A1
49CYP2C19 deficient patients have ________ exposure to the drug PPI
- AC. Same
- BB. Lower
- CD. No
- DA. Higher
50A leukemia patient with low TPMT activity should use ____________ dosage of mercaptopurine.
- ALower
- B Same
- C No
- D Higher
51Which is FALSE about autosomal recessive disorders?
- A One normal copy is sufficient for normal function
- B Disease develops if both copies are mutated
- CIt is a genetic problem at the autosomes, not on sex chromosomes
- DOne mutant allele is sufficient to cause disorders
52Which group do 6-Thiopurines and 6-Mercaptopurine (6-MP) belong to?
- A Deoxycytidine Analogs
- B Purine Antagonists
- C Antifolates
- DFluoropyrimidines
53About 80-85% of 5-FU is catabolized by the enzyme dihydropyrimidine dehydrogenase (DPD). If the patient has DPD deficiency, what will happen?
- AThe treatment exhibits less effect due to active clearance
- BThe treatment has better outcome because DPD enchances 5-FU activity.
- CNothing would happen since DPD is not involved in the metabolism of 5-FU
- DThe patient would suffer severe adverse effects such as myelosuppression, diarrhea, etc.
54Capecitabine is unique since it is hydrolyzed to 5-FU in _______ because the concentration of thymidine phosphorylase is higher in these cells.
- A normal epithelial cells
- Bnormal mesenchymal cells
- Cbreast tumor cells
- Dnormal liver cells
55Which of the following 5-Fluorouracil derivatives interferes with RNA processing by incorporating into RNA?
- AFdUMP
- BNone of the
- CFdUTP
- DFUTP
56Which is TRUE about multidrug-resistant phenotype?
- A P-glycoprotein leads to lower drug efflux
- B P-glycoprotein enhances intracellular accumulation of a broad range of anticancer agents
- CMDR1 gene encodes a cell surface transporter glycoprotein called P-glycoprotein
- D associated with decreased expression of the MDR1 gene
57The p53 gene is a(n) ____________. The _______of p53 will give rise to the neoplastic phenotype.
- ATumor suppressor gene; Activation
- B Oncogene; Deletion
- CTyrosine kinase; Activation
- DTumor suppressor gene; Deletion
58Aromatase inhibitors convert estrogen to androgen and therefore are effective in treating pre-menopausal women with advanced breast cancer
- ATrue
- BFalse
59Arsenic trioxide (As2O3) induces remission in patients with APL (acute promyetocytic leukemia) and one of the mechanisms is to induce apoptosis through a mitochondrion-dependent process, resulting in subsequent release of cytochrome C with caspase activation
- ATrue
- BFalse
60Asparaginase was used to treat childhood ALL (acute lymphoblastic leukemia) because tumor cells in ALL lack asparagine synthetase. So, depletion of L-asparagine by asparaginase leads to effective inhibition of protein synthesis.
- ATrue
- BFalse
61Cetuximab & Panitumumab target _____________
- AB. epidermal growth factor receptor (EGFR)
- BD. estrogen receptor (ER)
- CC. thyroid hormone receptor (TR)
- DA. androgen receptor (AR)
62What is SNP in genetics?
- AShort Nasal Pendulum
- BSingle Nucleotide Polymorphism
- C Severe Neuronal Paralysis
- DStandard & Poors
63Selective Estrogen Receptor Modulators (SERMs) such as Nolvadex (tamoxifen) can reduce tumor growth by increasing the interaction of estrogen to its receptors in breast tissue
- ATrue
- BFalse
64Tretinoin (all-trans-retinoic acid) is effective in patients with RAR-PML fusion oncuprotein.
- ATrue
- BFalse
65All of the anti-tumor antibiotics come from the soil microbe _____________
- AMycoplasma
- BStreptomyces
- C Clostridium
- DBacillus
66Scientists at the NIH developed a small peptide similar to BLEOMYCIN. It contains a DNA-binding region and an iron-binding domain at opposite ends. What would be the putative mode of action?
- A It promotes microtubule assembly
- B It blocks hypoxanthine-guanine phosphoribosyl transferase
- C It inhibits DNA biosynthesis
- DIt binds to cellular membranes to alter membrane fluidity
67Imatinib, dasatinib, and nilotinib are inhibitors of ______________
- A Topoisomerase
- B Tyrosine kinase
- C Thiopurine methyltransferase
- D DNA polymerase
68Paclitaxel exhibits high-affinity binding to microtubules with enhancement of tubulin polymerization in the absence of microtubule-associated proteins and guanosine triphosphate, and therefore results in inhibition of mitosis and cell division.
- ATrue
- BFalse
69 Antifolate drugs belong to the family of antimetabolites
- ATrue
- BFalse
70Majority of alkylations occur on the _____ position of guanine in DNA
- AN1
- B O1
- CN2
- DN7
71Nitrosoureas are highly lipid-soluble so they ______________
- Aincrease cell proliferation
- B cause obesity
- C are effective in treatment of brain tumors
- D can not cross the blood-brain barrier
72An X-linked dominant disorder requires a double dose of the variant allele on the pair of autosomal chromosomes
- ATrue
- BFalse
73All of the following applied as it relates to the structure of DNA except
- ANitrogenous base is lipophilic and stay away from the aqueous environment
- Bribose is polar and help help solubilizing the DNA in aqueous environment
- CPhospahte backbone is negatively charged and establish a hydrogen bond with opposite base of complementary strand
- DNitrogenous base forces the DNA to adopt a helical shape and stack with other bases through hydrophobic interaction
74DNA is more stable than RNA due to
- APresent of strong backbone
- Bpresent of Oxygen and magnesium ion
- Cdue to it z and A forms
- Ddue to the present of Uracil
75What is the different between purine and pyrimidine
- Apurine is one ring system while pyrimidine is a double ring structure
- Bpurine consist of A AND C while pyrimidine consist of G,T,U
- CPurine is two ring system while pyrimidine is a single ring system
76What makes condensation possible despite the repulsion between negative charges of the phosphates backbone
- Athe repulsion is not strong enough to stand condensation
- Bthe inorganic metal ions and cationic histone protein like arginine rich
- Corganic molecule such as adenine, uracil,guanine
77As it relates to DNA denaturation and renaturation which of the following is false
- AA-T has two hydrogen bond whereas C-G has three hydrogen bonds
- Bthe higher the G+C the higher the Tm
- Ctemperature of 25 below Tm and higher DNA concentration facilitates
- DC-G need less heat as compare to A-T to break the bonds
78what is false about What will happen when a primer does not bind at very end of the chromosomes and what can be done to change it
- Aevery replication cycles shortens one strand which is problematic
- Btelomerase binds to the terminal telomere nad catalyzes the addition of nucleotides at 3-prime end
- Cevery replication cycle will be longer which is problematic
- Dprimers attaches to the newly form okazaki fragment for lagging strand.
79which of the following is false about PROKARYOTIC enzymes
- APol II is use to filling in the gap after removal of RNA primers
- BPOL II is use for DNA repair
- CPol III is use for DNA synthesis
- Dpoly I is use to filling in the gap after removal of RNA primers
80all of the following are causes of DNA mutation except
- ATautomerization and point mutation
- Bradiation and chemical mutagen
- Cinsertion and deletion
- Dreplication and proofreading corrections
81the active site of polymerization and the 3 to 5 prime exonuclease reactions must be same, because it is important for the exonucleolytic reaction
- ATrue
- BFalse
82pyrophosphorolysis is the exaclt opposite of DNA synthesis
- ATrue
- BFalse
83Spontaneous mutation are those that result from no external cause and can occur simple by arrangement of bonds
- ATrue
- BFalse
84_________ has an anticodon and carries specific amino acid molecules at the ribosome to form a polypeptide chain.
- AtRNA
- BmRNA
- CrRNA
85_________ is responsible for carrying the information of DNA to the ribosome during protein synthesis.
- ArRNA
- BmRNA
- CtRNA
86A riboswitch functions through the interference of a small molecule with the ____________molecule
- AmRNA
- BtRNA
- CrRNA
87During DNA repair, a homologous recombination works at double strand breaks. It never causes any mutation.
- ATrue
- BFalse
88If the DNA strand, 5′–GCTATGCATCGTGATCGAATTGCGT–3′, serves as a template for the synthesis of RNA, which of the following choices gives the sequence and polarity of the newly synthesized RNA?
- A5′–UGCGUUAAGCUAGUGCUACGUAUCG–3′
- B5′–CGAUACGUAGCACUAGCUUAACGCA–3
- C5′–GCTATGCATCGTGATCGAATTGCGT–3
- D5′–ACGCAATTCGATCACGATGCATAGC–3′
- E
5′–ACGCAAUUCGAUCACGAUGCAUAGC–3′
- A5′–UGCGUUAAGCUAGUGCUACGUAUCG–3′
89Anti-cancer treatments take advantage of nucleotide synthesis as a means to attack dividing cells
- ATrue
- BFalse
90 Purine and pyrimidine metabolism is tightly regulated, primarily through feedback inhibition of synthesis
- ATrue
- BFalse
91De novo synthesis pathways are very energy intensive because 6 ATPs and 1 GTP are required to produce single adenosine monophosphate
- ATrue
- BFalse
92the extraction of nitrogen from glatamine to transfer to carbon 1 represents the 1st committed step of the purine biosynthetic pathway is
- Anon committed step
- Bfirst committed step
- Csecond committed step
- Dslight committed step
93Guanosine monophosphate kinase converts GMP to GDP and DOES convert AMP to ADP
- ATrue
- BFalse
947 ATPs are utilized to produce the purine nucleotide GMP
- ATrue
- BFalse
956ATPs and 1 GTP are utilized to produce the purine nucleotide AMP
- ATrue
- BFalse
96Allopurinol inhibits the activity of xanthine oxidase and prevents uric acid formation
- ATrue
- BFalse
97Clinical relevance of uric acid accumulation
- AKidney Stone
- BHyperuricemia
- CGOUT
- DALL OF THE ABOVE
98In lymphocytes, major route of generation of nucleotides occurs via salvage pathway
- ATrue
- BFalse
99Anti cancer drug 6-Mercaptopurine (6-MP) exploits HGPRT for the bioactivation
- ATrue
- BFalse
100Cytidine triphosphate synthetase is use to convert UTP to CTP
- ATrue
- BFalse
101--------------------- is transferred to PRPP to form OMP (orotidine-5-monophosphate)
- ACTP
- BUTP
- COrotate
- DdOMP
102Which of the following serves as a false substrate for the critical nucleotide biosynthesis enzymes thymidylate synthase
- AMethothrexate
- B5 fluorodeoxyuridine monophosphate
- Cfolic acid
- Duric acid
1035 fluorouracil block the conversion of dUMP to dTMP
- ATrue
- BFalse
104Antimetabolites are structurally similar to the endogenous metabolites . They can not be utilized by the body in a productive manner.
- ATrue
- BFalse
105The competitive inhibitor (drug) methotrexate inhibits enzyme
- Aribonucleotide reductase
- Bdihydrofolate reductase
- Cthymidylate synthase
- Dnone of the above
106all of the following are needed for the synthesis of CTP from UTP except
- Aglutamine
- BATP and Water
- Cctp synthase
- DAspartate
107Methylation by TPMT _______ the incorporation of Mercaptopurine into extending DNA! Delivery of the standard dosage to a patient with ____TPMT activity causes severe side effects
- Aincreases; higher
- Bdecreases; lower
- C increases; lower
- Ddecreases; higher
108HPV vaccine Gardasil targets E 6 and E 7 since they are HPV oncogens
- ATrue
- BFalse
109each B-cell produces --------- kind of Ab
- Athree
- Bfour
- Cone
- Dtwo
110Which of the mediated mechanism does not have direct cleavage mRNA
- Aribozymes
- BRNA inference
- Cantisense oligonucleotide
111Extremely rapid CYP2C19 deficiency would have---------- exposure to PPI, therefore exhibting --------- probability of ulcer cure than wild types
- Ahigher,higher
- Blower,lower
- Clower,higher
- Dhigher,lower
112In Prokaryotes, are three different RNA polymerase
- ATrue
- BFalse
113IF there is an incorrect matching between the codon and anticodon sequences, there is no conformational change in the small ribosomal subunit and no hydrolysis of GTP bound to the EF-Tu
- ATrue
- BFalse
114Asian psychiatric patients require ----------------- dose for benzodiazepine (alprazolam and diazepam) because white have a ........................ plasma concerntration than asian
- Ahigher,higher
- Blower, lower
- Clower, higher
- Dhigher, lower
115Which of the following is not a characteristic of gardasil
- AMajor capsid protein l1
- Bno viral DNA
- C induce cancer
- Dtrigger antibody response
116Omeprazole is a PPI ( proton pump inhibitor) which is inactivated by CYP2C19, therefore a patient with deficient in CYP2c19 will.................... exposure to drug and ......................... probability of ulcer cure
- Ahigher, lower
- Bhigher, higher
- Clower,higher
- Dlower, lower
117CCG TO CGA is
- Asense
- Bnon-sense
- Cmissense
- Dsynonymous
118a drug such as erthromycin that bind to the Large subunit of rRNA will inhibit
- ATranslocation
- BEF-TU
- CTranspectidation
- DEF-G
119streptomycin inhibit
- Aelongation of transcription
- Belongation of translation
- Cinhibit proofreading
- Dinitiation of translation
Information
- Description
- Quiz on Pharm 511, created by Wilde Ketchatang on 19/09/2015.
- Author
- Wilde Ketchatang
- Language
- English
- Views
- 6
- History
- Created on 19 Sep 2015 · updated on 19 Feb 2016
- Rating
- No ratings yet Rate this quiz