Dougies lectures

Page 1

Therapeutic cloning

Differentiated Cells

specialized or differentiated cells have particular roles in the body eg, blood/nerve/muscle cells

cant divide to make a copy of themself

stem cells replace specialized cells that die/damage/get used up

Why stem cells renew and differentiate?

1 stem cell = self renewal maintains the stem cell pool

4 specialized cells = replaces dead or damaged cells throughout life

Where are stem cells found?

embryonic stem cells = blastocyst (early embryo 50-100 cells)

tissue stem cells = fetus,baby & throughout life

Embryonic stem cells, where they come from?

cells

are taken from inside the blastocyst, a very early stage embryo

Es cells are found in inner cell mass of blastocyst

Tissue Stem cells

found in muscle,brain,skin,testicles,intestines,bone marrow

can make several kinds of specialized cells (multipotent)

more limited than embryonic cells

Induced

pluripotent stem cells

Researchers

hope that one day they might be able to use iPS cells to help treat diseases like

Parkinson’s or Alzheimer’s. They hope to:

1)Take cells from the body - like

skin cells - from a patient

2)Make iPS

cells

3)Use those iPS cells to grow the specialized cells the

patient needs to recover from the disease, e.g. certain brain cells. These

cells would be made from the patient’s own skin cells so the body would

not reject them.

Page 2

Transgenic Animals

Transgene

foreign

DNA that has been inserted

into the genome

of

a complexed

organism,

through

experimental manipulation of early stage embryos or germ cells.

Transgenic organism

Any

organism carrying a transgene

Transgenic animals

Insects

- Drosophila

Vertebrates - Mammals & fish

Creation of transgenic mice

Method

1 = Microinjection of DNA directly

into fertilised egg

Method

2 = Use

of Embryonic Stem (ES) cells

Blastocyst

= a mammalian embryo at the stage where it is implanted in the wall of the womb

Pronucleus - the nucleus of a fully matured

ovum or spermatozoan before the nuclei are fused during

fertilization

METHOD 1 Microinjection of DNA directly into fertilised

egg

1. insert ‘foreign’ DNA =

transgene into

appropriate vector

2. Obtain fertilised eggs from

the oviduct of female animal.

3. Microinject

transgene into the male pronucleus of a

recently fertilised egg.

4. Allow transgene to be stably

integrated into

the

embryo’s

chromosomes.

5. Culture embryos until the blastocyst

stage

and then implant

into pseudopregnant

foster

female.

Disadvantage - inefficient process

Totipotent

cell - a cell that can give rise to all types of differentiated cell

METHOD 2 Use of Embryonic Stem

(ES) cells

ES

cells are immortalised

totipotent cells from inner

cell mass

of an

early embryo

1. Culture

embryonic stem (ES) cells

from organism

2. Transfect the

ES cells with vector containing the transgene.

3. Select correctly transfected cells (using a

selectable marker on vector) and introduce into developing embryos at

blastocyst stage.

4. Implant into pseudopregnant

female

Advantage - More efficient as successfully transformed

cells can be selected before transfer to embryo.

Pharm Animals

Transgenic

animals used as bioreactors for

the production of recombinant proteins that have pharmaceutical applications.

Animal pharming using transgenic

livestock

The properties of milk are a renewable resource to produce functional enzymes,

antibodies and structural proteins using existing dairy manufacturing processes

Purification

of proteins from milk is easier than from cultured cells or blood

High

levels of recombinant proteins produced throughout lifetime of animal

uses transcriptional promoters

of mammary-specific

genes to direct the expression of

soluble transgenic proteins.

Mammary

glands

First

cloned

farm animal ‘Dolly’

derived from DNA

from mammary

gland of

adult sheep.

Recombinant

proteins produced in the milk of Pharm animals

using vectors with mammary gland promoters.

Page 3

Reproductive Cloning of Mammals

Cloning = process of producing populations

of genetically-identical cells or organisms

Cloning in molecular biology refers to processes used to

create copies of DNA fragments =

molecular cloning

Somatic diploid cell = any cell in the body with the exception of germ

cells e.g.

skin cells

Animal cloning technology

microinject

or fuse enucleated unfertilized egg cells with diploid

nuclei from somatic cells grown in culture = whole nuclear transfer

can produce clone(s) of the

animal that was the donor of the nuclei

can produce hundreds of identical animals

in a single generation.

The Roslin technique

First successful cloning of mammal from adult cells

Donor cell selected from cultured udder cells of a Finn Dorset sheep in vitro

Donor cell was taken from the culture and then

starved so it entered the G0 stage.

The egg cell of a Blackface ewe was then enucleated and

placed next to donor cell.

Electric current used to fuse the cells and activate

the development of an embryo.

Surviving embryos then grew for six days in culture

before transplantation to sheep's oviduct for six days

Finally, the embryos were placed into the uterus of a surrogate mother ewe

resulting in DOLLY

Why starve cell to enter G0 stage?

If DNA of the embryo cell was not in same stage of the cell cycle as the egg's cell DNA, then cloning would be

ineffective.

The Honolulu

nuclear transfer technique

Higher success rate than Roslin technique

Wakayama used cumulus

cells. = cell which clings to an

egg cell prior to ovulation in females.

That are almost always in

either the G0 or G1 state.

Nucleus from the cumulus

cells was microinjected into the enucleated egg and after a few

hours injected eggs were placed in calcium free media containing strontium to

jumpstart the embryos development.

(less strenous than electric shock)

Cytochalasin B is included

in the oocyte activation media to prevent polar body formation which results in chromosome loss.

Then developing

embryo transplanted into ‘surrogate’ mother mouse

After a normal gestation

period, a cloned mouse is born

Page 4

PCR Advanced Techniques

PCR can mass produce DNA molecules from small amounts of material

PCR

reaction components

DNA

template

Taq

polymerase: heat stable DNA polymerase, to

synthesise identical copies of a specific segment of DNA in

vitro

Equal concentration of excess deoxynucleotides (dNTPs)

Mg2+ ion

concentration is critical and sometimes needs optimisatio

2 oligonucleotide primers that hybridise to separate strands flanking the region of interest of the DNA

PCR involves three steps:

1. Denaturation

of template DNA by heat (93 -96°C)

2. Annealing

of primers to template DNA (40 - 60°C)

3. Extension of

DNA by Taq polymerase (72°C)

PCR requires:

Heating block with

an automated thermal cycler

Each group of three steps is termed

a PCR

cycle and theoretically

doubles the amount of the original target sequence.

To amplify enough DNA to use in

subsequent experiments generally a PCR reaction is carried out for 20-40 PCR cycles.

DNA amount doubles in each cycle = 2n,

where 'n' is the number of cycles.

PCR

conditions

Primer sequences

Annealing temperature

Mg2+ concentration

Design of primers

Perfect

match – perfect complimentarity between single stranded template DNA

and oligonucleotide primer

Internal

mismatch in base pairing between primer and

template – PCR will work but annealing temperature needs reduced

3’ mismatch – PCR will not work

5’ mismatch – PCR will work. used for incorporating a restriction

enzyme recognition site at the 5’ end for cloning

Primer sequences

GC content of primers should be

roughly the same = melting temperature roughly the

same

GC content between 40-60% good

Make sure they are not complementary to each other or self, especially

at 3’

end.cos primer dimers may form.

Not

homologous to any sequences repeated in genome

Annealing

temperature

Annealing temperature calculated from the base sequence and

length

Longer

oligonucleotides form more hydrogen bonds with a target

so have a higher

annealing temperature.

G or C nucleotides in

an oligonucleotide affect annealing temperature because GC

base pairs form three H bonds and AT base pairs form only two.

If there is mis-match between the

oligonucleotide and the target, annealing temperature will be lower

Typical annealing temperature = 50 to 60 degrees.

Low an annealing temperatures = non-specific

products may be amplified.

Annealing

temperature and Mg2+ concentration

If extra DNA fragments = increase annealing temperature/decrease Mg2+ concentration

If

no DNA amplified = decrease temperature/increase Mg2+

concentration

"Hot Start" PCR:

Taq polymerase is active at temperatures below 72oC

If

primers mis-anneal

at low temperature prior to initial template denaturation,

"non-specific" amplification may occur.

Avoid by only adding enzyme after intial denaturation, before it cools to annealing temp

"Touchdown" PCR

start high anneal temp, lower

gradually, 1°C

every 2nd cycle

method where you program the

thermocycler to deliver slightly lower

annealing temperatures in each cycle

Why does touchdown PCR help?

first few cycles, nothing works because the annealing temperature is too

high.

At one point reactions will work because an appropriate temperature

will have been reached.

First reaction that works will be very specific,

because it will take place at a high temperature.

So specific reactions get a headstart

on the non-specific reactions, which might not start until annealing

temperature drops more.

Long PCR

Uses 2nd thermostable DNA polymerase with a 3’-to-5’-exonuclease, or “proofreading” activity

in addition to Taq polymerase PCR

may be extended to 10-40 kb compared with traditional

PCR of up to 10 kb at maximum

RT-PCR

Use

RNA

as starting template with reverse transcriptase

to synthesise cDNA with a specific primer.

Use

first strand cDNA as template for PCR.

Nested PCR

Useful

for products of low abundance

One round of 15-25 PCR cycles on cDNA or genomic DNA generates large product.

Second round of PCR using one or a new set of internal

primers with the first round of DNA as

template

Inverse PCR (learn diagram)

Amplifies unknown DNA sequence flanking a region of known

sequence.

DNA

is cut with a restriction enzyme that cuts in the unknown flanking regions, so

that the known sequence is in the middle.

This

restriction fragment is circularised and cut with a second restriction

enzyme that cuts within the known sequence.

The

now linear DNA will have part of the known sequence at each terminus.

Using

primers to the known sequence the unknown region can be amplified by PCR.

T-A Cloning Strategy

Use PCR product directly

Taq polymerase adds extra adenosine nucleotide at the 3’ terminus of each strand

Clone this using a special cloning vector which carries T overhangs

Incorporation of Restriction

Sites in Primers

Use oligonucleotides with restriction sites at their 5’end

Should have AT LEAST two additional bases 5' to the recognition

sequence to make sure enzymes will recognise the sequence

Page 5

PCR Tutorial

Question 1.

If

a single copy of DNA was amplified by using 25 cycles of PCR how many copies of

the sequence would be synthesised assuming 100% efficiency?

Answer

Use 2^n where n is

the number of PCR cycles

Number of copies would be 2^25

= 33554432

Question 2.

A

protein has the amino and carboxy terminal peptide sequences MRDYNKW and EMKAWRH

respectively. Using the codon wheel below design a forward and reverse primers

that could be used in PCR to amplify the gene encoding this protein.

Answer

First do the amino sequence for forward primer which is MRDYNKW

Reverse translate it using wheel so go backwards on wheel = 5’ ATGAGAGACTACAACAAATGG 3’

Then use carboxy sequence for reverse primer which is EMKAWRH

Reverse translate it using wheel = 5’ GAAATGAAAGCATGGAGACAC 3’ and reverse complement it = 5’

ATGACGCCAAGCCTTCATCTC 3’

Question

3.

Design primers of 20 nucleotides in length that would PCR amplify as much of the following sequence as possible. Please indicate the area to which you

designed each of the primers by drawing a boxes around the appropriate areas of

the sequence below.

5'GACAGACATAGGGATTCCGTGGGGCGATCCTTCGCGCGCGATGCATGCCGTAATACTATGCGCATAGTATCATCCTAGGTACCGTACTTATATAAGTACGGAATCGCTAAGTGTCTCAAAAAAAGCAT-3'

Answer (see tutorial full)

Good

primers should have a GC% of 45-55 % so in primers of 20 nucleotides in length

this would be 9 – 11 G+Cs

Generally

it is good if the GC% identical if possible as this would mean that the

annealing temperature would be similar. Highlighted below are areas at either

end of the sequence that have these properties. Note that the sequence at the

3’ of the original sequence is too A+T rich.

Page 6