Final Exam

1. 1To be useful in genetic engineering a vector must have

   1. AHave no marker genes
   2. BEnzymatic properties
   3. CContain control sequences
   4. DVery small DNA storage capacity
2. 2If one needs to derive a cDNA of human insulin, which cells should be taken for DNA extraction?

   1. AAny cell of the human body as the DNA is the same in all cells
   2. BA germ line cell
   3. CCells of the pancreas
   4. DCells of the liver
3. 3Which of the following would be required, in addition to the human insulin gene, to provide a recombinant plasmid?
   
   

   1. ADNA Ligase
   2. BDNA Polymerase
   3. CRNA polymerase
   4. DReverse transcriptase
4. 4Restriction Endonucleases can recognize

   1. ATandem Repeats
   2. BPalindromic sequences
   3. CGATC
   4. DNo sequence specifity
5. 5Molecular probes used for the identification of transformed cells may be;

   1. ARecombinant DNA
   2. BFlorescence
   3. CDyes
   4. DPalindromes
6. 6Question 6

   

   1. A1
   2. B2
   3. C3
   4. D4
7. 7Plasmid vector in DNA recombinant technology means

   1. A1. a virus that transfers genes to a bacteria
   2. B2. extra-chromosomal autonomously replicating circular DNA
   3. Csticky end of FNA
   4. DAny fragment of DNA carrying desirable genes
8. 8Choose

   

   1. AA
   2. BB
   3. CC
   4. DD
9. 9SCID or severe combined immune deficiency disorder is a disease that affects the enzyme ____________ and can be treated with genetic engineering of T-cells.

   1. Aa. transferase
   2. Bb. protease
   3. Cc. lipase
   4. Dd. adenosine deaminase
   5. Ee. Exonuclease
10. 10The function of DNA ligase in genetic engineering is to:
    
    

    1. AA. Cause the cloning of recombinant DNA
    2. BB. Fragment the DNA extracted from cells
    3. CC. Join plasmid DNA and inserted DNA
    4. DD. Catalyze the formation of cDNA from mRNA

11. 11How are transformants selected from non-transformants

    1. A1. Presence of more than one recognition sites in the vector DNA
    2. B2. Presence of alien DNA into the vector DNA results into insertional inactivation of selectable marker.
    3. C3. Antibiotic resistance gene gets inactivated due to insertion of alien DNA
    4. D4. Both 2 and 3
12. 12Introduction of DNA molecules into the recipient organism is termed as ____________
    
    
    

    1. Aa) transformation
    2. Bb) translation
    3. Cc) transduction
    4. Dd) transcription
13. 13Choose the correct answer

    

    1. AA
    2. BB
    3. CC
    4. DD
14. 14electroporation facilitates insertion of foreign DNA into the cell by

    1. A1. Changing the porosity of the membrane
    2. B2. Changing the electrical potential of the membrane
    3. C3. Lysing the cell wall
    4. D4. Active transport
15. 15Isolating the gene needed for genetic engineering can be done by:
    
    
    
    

    1. AA. Creating mRNA of the required gene
    2. BB. Using heat shock
    3. CC. Creating the gene artificially from nucleotides
    4. DD. Electrophoresis
16. 16For what purpose are restriction enzymes used in the production of recombinant DNA?
    
    
    

    1. AA. forming DNA from mRNA
    2. BB. cutting open the circular DNA of plasmids
    3. CC. joining pieces of DNA to form recombinant DNA
    4. DD. breaking down bacterial cell walls to release plasmids
17. 17Electroporation is also used for taking up the DNA by the cells. It constitutes of ____________
    
    
    
    
    
    
    
    
    

    1. AA. Inserting DNA into the host cell via plasmids
    2. BB. Inserting DNA into the host cell via viruses
    3. CC. Inserting DNA into host cell via ice cold calcium solution followed by heat shock is responsible for affecting the efficiency of DNA uptake
    4. DD. Inserting the DNA into the cells via an electric shock
18. 18What does Cas9 protein do?
    
    
    
    
    

    1. AA.Cut DNA
    2. BB.Cut RNA
    3. CC.Bind to RNA
    4. DD.Bind to DNA
19. 19Vectors in gene technology are molecules that:
    
    
    
    
    
    

    1. AA.A DNA molecule that is used as a vehicle to carry a particular DNA segment into a host cell
    2. BB.DNA that is formed from a combination of DNA from two different sources
    3. CC.Protect bacterial cells from invasion by foreign DNA
    4. DD.Cut the viral genetic material into smaller pieces at specific nucleotide sequences
20. 20Plasmids are good vectors for genetic engineering because:
    
    Question 20Select one:
    
    

    1. AA.They can easily extract recombinant DNA from bacteria
    2. BB.They self replicate within bacterial cells
    3. CC.They contain restriction enzymes
    4. DD.They can easily infect bacteria
21. 21What is an example of disruptive selection?
    
    
    
    
    

    1. AA. Human babies with an average birth weight are more likely to survive than a baby that is either too small or too large.
    2. BB. Moderate numbers of spines occur in cacti to avoid parasites attracted by too many spine and protect them from predators that feed on them if the spines are lesser.
    3. CC. A new predator feeding on small sized fish, leading to an increase in the large fish population.
    4. DD. The presence of more light colored peppered moths in rural areas compared to more dark peppered moths in the industrial areas. Few medium-colored moths are present in either location.
22. 22What principle is NOT included in Darwin’s Theory of Natural Selection?
    
    
    
    
    
    
    

    1. AA. Struggle for existence
    2. BB. Fitness
    3. CC. Overproduction
    4. DD. Variation
    5. EE. Isolation
23. 23
    “Although they live in the same environment/habitat the American toad breeds earlier in the spring than the Fowler toad. What can be inferred about the type of isolation occurring in these two species?”
    
    And the options you provided were:
    
    

    1. AA. Geographic isolation
    2. BB. Behavioral isolation
    3. CC. Mechanical isolation
    4. DD. Ecological isolation
    5. EE. Temporal Isolation
24. 24The reproductive isolating factor occurring when the F2 generation crosses with its species or parental species and reproductive failure occurs as infertile generations of offspring.

    1. AA. Hybrid sterility
    2. BB. Hybrid in viability
    3. CC. Hybrid gametic isolation ”
    4. DD. Hybrid breakdown
25. 25The similarity of bone structure in the forelimbs of many vertebrates is an example of?
    
    

    1. AA. Homologous structures
    2. BB. Natural Selection
    3. CC. Analogous structures
    4. DD. Stabilizing selection
26. 26Which of the following best describes ‘fitness’?
    
    
    

    1. AA. The species with the best genes and adaptations survives
    2. BB. The ability of an organism to survive its environment
    3. CC. The ability of an organism to pass on its traits via reproduction
    4. DD. Strength of an organism
27. 27Which one of the following is an example of continuous variation in Man?
    
    

    1. AA. Finger prints
    2. BB. Eye colour
    3. CC. Finger length
    4. DD. Tongue rolling
28. 28Which of the following BEST explains the type of natural selection the distribution of sickle cell anemia in a population showcases?”
    
    
    
    

    1. AA. Directional
    2. BB. Disruptive
    3. CC. Stabilizing
29. 29Thin shelled oysters are more susceptible to being preyed upon than thick shelled oysters. To which type of natural selection does this example belong?

    1. AA. Directional selection
    2. BB. Stabilizing selection
    3. CC. Disruptive selection
30. 30Which of the following describes continuous traits?
    
    

    1. AA. Limited number of phenotypes with no intermediates
    2. BB. This type of variation involves qualitative traits
    3. CC. Polygenetic traits that can be influenced by the environment
    4. DD. The effect of alleles at a single gene locus determine the phenotypic expression
31. 31Artificial selection to obtain cows yielding high milk output represents
    
    
    

    1. A(1) Stabilising
    2. B(2) Directional
    3. C(3) Disruptive
    4. D(4) Stabilizing followed by disruptive
32. 32Choose

    

    1. AA
    2. BB
    3. CC
    4. DD
33. 33Choose

    

    1. AA
    2. BB
    3. CC
    4. DD
34. 34Which of the following features can be BEST used to determine whether sexually reproducing flowering plants from separate populations are members of the same species?

    1. A(A) They have the ability to cross-fertilize
    2. B(B) They have the ability to cross-pollinate.
    3. C(C) They have the ability to produce viable seeds.
    4. D(D) The viable seeds can produce fertile gametes
35. 35A variation of a species’ traits into types that are found in discrete categories can be represented by:”
    
    

    1. AA. Histogram
    2. BB. Bell curve
    3. CC. Bar Chart
    4. DD. Line Graph
36. 36"There are various isolating mechanisms which can result in populations of the same species evolving into two distinct species. Which of the following is an example of behavioural isolation?
    
    

    1. A(A) Pinus radiata flowers in February while Pinus attenuata flowers in April.
    2. B(B) Viola arvensis grows on calcareous soils whereas Viola tricolor prefers acidic soils.
    3. C© The flower structure of certain orchids prevents the transfer of pollen from another species
    4. D(D) In species of funnel web spiders, only males which spray the female with a chemical substance, are allowed to mate with her."
37. 37Which of these features show discontinuous variation?”
    

    1. AA. Sex
    2. BB. Shoe size
    3. CC. Learning ability
    4. DD. Hand span
38. 38Which type of isolation plays the MOST significant role in allopatric speciation?” The options are:
    
    

    1. A(A) Temporal
    2. B(B) Ecological
    3. C© Behavioural
    4. D(D) Geographical
39. 39Hemophilia is caused by a sex-linked, recessive allele. Two parents have a hemophiliac son, a normal son and a hemophiliac daughter.
    
    What are the most likely genotypes of the parents?
    
    
    

    1. AA.
       Xh Xh and XH Y
    2. BXH XH and Xh Y
    3. CXH Xh and Xh Y
    4. DXh Xh and Xh Y
40. 40A normal man marries a colorblind woman. How many of their sons will be colorblind?
    
    
    
    
    
    
    
    

    1. AA. 75%
    2. BB. 50%
    3. CC. 100 %
    4. DD. 25%
41. 41Some dogs bark while trailing while others are silent. Barking the dominant trait. Standing ears are dominant to drooping ears.
    
    B = barking b= silent
    
    S = standing ears s= drooping ears
    
    From the cross between a heterozygous father and a homozygous recessive mother, deduce the following:
    
    What are the parents gametes?
    
    Mother: [blank_start]bs[blank_end] [blank_start]bs[blank_end] [blank_start]bs[blank_end] [blank_start]bs[blank_end]
    
    Father: [blank_start]BS[blank_end] [blank_start]Bs[blank_end] [blank_start]bS[blank_end] [blank_start]bs[blank_end]
    
    What is the phenotypic ratio?
    [blank_start]1:1:1:1[blank_end]
    
    

    1. Abs
    2. Bbs
    3. Cbs
    4. Dbs
    5. EBS
    6. FBs
    7. GbS
    8. Hbs
    9. I1:1:1:1
42. 42In a paternity suit, a female with blood type AB has accused a male with blood group A of being the father of her child. The child has blood type BO. What is the genotype of the accused male which will prove that he is the father of the child?
    
    
    
    
    
    
    
    
    

    1. AA. OO
    2. BB. AB
    3. CC. AO
    4. DD. AA
43. 43Coat colour in Labrador retriever is controlled by epistasis. B specifies black pigment, b is for brown pigment (recessive) and E locus determines the expression of B/b traits. Which one of the following is wrong?
    

    1. Aa) bb EE gives yellow
    2. Bb) Bb EE gives black
    3. Cc) bb Ee gives brown
    4. Dd) BB EE gives black
44. 44Mrs. Gordon is carrier of the sex-linked trait for hemophilia allele and Mr. Gordon is normal. What is the probability of their sons being having hemophilia?
    
    
    
    
    
    
    

    1. AA.25%
    2. BB.50 %
    3. CC.75%
    4. DD.100%
45. 45Fur colour in mice is controlled by a pair of genes occupying different loci- W represents the presence of colour, "w" represents albino. The allele for brown fur is "A" and for black fur is "a".
    
    The genotype wwAa is:
    
    
    
    
    
    
    
    
    
    
    
    

    1. AA.Black with brown spots
    2. BB.Black
    3. CC.Albino
    4. DD.Brown
46. 46In Shorthorn cattle, the allele for hornless (h) is dominant to the allele for the presence of horns (H). Coat colour can be red (genotype CRCR), roan (genotype CRCW) or white (genotype CWCW). A roan bull, heterozygous for the hornless trait, is crossed with a cow of the same genotype. What is the probability that a child from this cross would be the same genotype as its parents?

    1. AA. 1/4
    2. BB. 3/8
    3. CC. 1.2
    4. DD. 3.4
47. 47CHOOSE:
    
    
    
    
    
    
    
    

    

    1. AA.RRYY
    2. BB.RrYy
    3. CC.RrYY
    4. DD.rryy
48. 48Two parents think their baby was switched at the hospital. Its 1968, so DNA fingerprinting technology does not exist yet. The mother has blood type “O,” the father has blood type “AB,” and the baby has blood type “B.”
    
    Was the baby switched?

    1. AVerdadero
    2. BFalso
49. 49If a homozygous dominant organism is crossed with a heterozygote for the same trait, the offspring would
    
    .

    1. AA. Display the dominant phenotype
    2. BB. Be all homozygous recessive.
    3. CC. Be all homozygous dominant.
    4. DD. Present a 9:3:3:1 genotypic ratio."
50. 50A woman with type A blood and a man with type B blood could potentially have offspring with which of the following blood types?
    
    
    
    
    

    1. AA. type A
    2. BB. type B
    3. CC. type AB
    4. DD. type O
    5. EE. all of the above
51. 51Which of the following properties were present in the characters that Mendel examined in his breeding experiments?

    1. AA. The characters were controlled by a single gene.
    2. BB. The traits varied in an either-or fashion.
    3. CC. They were controlled by loci that were on different chromosomes.
    4. DD. All the above are true.
52. 52A plant of genotype GGhh was crossed with another of genotype ggHH. The resulting F1 plants were self-fertilised to produce the F2 generation.
    
    In the F2, what would be the expected frequency of plants with the genotype GgHh?
    
    

    1. AA 3/4
    2. BB 9/16
    3. CC 1/4
    4. DD 3/16
53. 53Following a SsYy x SsYy cross, what fraction of the offspring are predicted to have a genotype that is heterozygous for both characteristics?
    
    

    1. AA. 1/16
    2. BB. 2/16
    3. CC. 3/16
    4. DD. 4/16
54. 54An organism of genotype AaBb can make gametes of all the following kinds except:
    
    

    1. Aa. AB
    2. Bb. Bb
    3. Cc. aB
    4. Dd. ab
55. 55In rabbits, white fur (W) is dominant to black (w), and long ears (E) are dominant to short ears (e).
    A breeder mates two rabbits that are heterozygous (WwEe) for both traits.
    What is the chance that the offspring will be black with long ears?

    1. AA. 3/16
    2. BB. 1/4
    3. CC. 1/2
    4. DD. 1/8
    5. EE. 3/4
56. 56Flower colour is an example of incomplete dominance. When a red-flowered plant is crossed with a white-flowered plant, all offspring have pink flowers. If two pink-flowered plants are crossed their offspring would be
    
    

    1. AA. 50% red, 50% pink
    2. BB. 100% red
    3. CC. 25% red, 50% pink , 25% white
    4. DD. 75% red, 25% white."
57. 57In a dihybrid cross, AaBb x AaBb, what fraction of the offspring will be homozygous for both recessive traits?
    
    
    
    

    1. AA. 1/16
    2. BB. 1/8
    3. CC. 3/16
    4. DD. 3/4
58. 58A test cross was done on genotype BbCc. Which of teh following genotypes would you not expect among the offspring

    1. AA. bbcc
    2. BB. BbCc
    3. CC. Bbcc
    4. DD. BbCC
59. 59A red-flowered plant crossed with a white-flowered plant of the same species, produced F1
    
    plants which all had pink flowers. Self-pollination of the F1 plants produced an F2
    
    generation in which 39 plants had red flowers, 83 had pink flowers and 40 had white flowers.
    
    
    
    What does the experiment demonstrate?
    
    
    

    1. AA Codominance
    2. BB Multiple alleles
    3. CC Incomplete dominance
    4. DD Epistasis
60. 60Which of the following genetic crosses would be predicted to give a phenotypic ratio of 9:3:3:1?
    
    

    1. AA. SSYY x ssyy
    2. BB. SsYY x SSYy
    3. CC. SsYy x SsYy
    4. DD. SSyy x ssYY
    5. EE. ssYY x ssyy
61. 61
    Sure, here’s the transcription of the text in the image:
    
    "A scientist adds a fluorescent dye to dividing cells which stains the nuclear envelope. At which stages of the cell cycle would the nucleus be visible?
    
    1. Interphase
    2. Prophase
    3. Telophase
    4. Anaphase
    
    

    1. AA. 1 only
    2. BB. 1 and 3 only
    3. CC. 1,2 and 3 only
    4. DD. 1, 2, 3 and 4
62. 62Some chemotherapy treatments used to stop tumour growth work by preventing the DNA double helix from uncoiling and separating.
    
    During which stage of the cell cycle would they act?
    
    

    1. AA. anaphase
    2. BB. metaphase
    3. CC. prophase
    4. DD. interphase
63. 63Which is the correct statement concerning cell and nuclear division?
    
    
    
    
    

    1. AA.DNA is replicated in the G2 phase of the cell cycle.
    2. BB.Mutations in a cell's oncogenes can cause cancer.
    3. CC.Just before prophase the chromosome number is double the normal number. Following anaphase, the number is reduced by half and following cytokinesis this number halves again.
    4. DD.Some of the roles of mitosis are growth, sexual reproduction, cell repair following tissue damage and cell replacement
64. 64Which of the following is not true of homologous chromosomes?
    
    
    
    
    
    
    
    

    1. AA.They contain the same alleles.
    2. BB.They contain the same number of genes.
    3. CC.They have the same loci for all their genes.
    4. DD.Their centromeres are in the same position.
    5. EE.They are the same length.
    6. FF.Areas of euchromatin and heterochromatin are the same.
65. 65"For sexually reproducing diploid parent cells, which of the following statements best explains the production of haploid cells that occurs in meiosis but not in mitosis?
    
    

    1. AA. Separation of chromatids occurs once, and there is one round of cell division in meiosis.
    2. BB. Separation of chromatids occurs twice, and there are two rounds of cell division in mitosis.
    3. CC. Separation of chromatids occurs once, and there are two rounds of cell division in meiosis.
    4. DD. Separation of chromatids occurs twice, and there is one round of cell division in mitosis."
66. 66Corn cells have 20 chromosomes. If it is dividing mitotically, how many chromosomes will be present at prophase?

    1. AA. 5
    2. BB. 40
    3. CC. 10
    4. DD. 20
67. 67At what stage in the cell cycle would DNA be replicated?
    
    
    
    
    

    1. AA.Interphase
    2. BB.G2 phase
    3. CC.S phase
    4. DD.G1 phase
68. 68Select

    

    1. AA
    2. BB
    3. CC
    4. DD
69. 69During meiosis, chromatids of individual chromosomes separate during ___?
    
    
    
    

    1. A1. Metaphase I
    2. B2. Anaphase I
    3. C3. Anaphase II
    4. D4. Metaphase II
70. 70Select

    

    1. AA
    2. BB
    3. CC
    4. DD
71. 71Choose

    

    1. AA
    2. BB
    3. CC
    4. DD
72. 72Choose

    

    1. AA
    2. BB
    3. CC
    4. DD
73. 73Sweet pea plants have a diploid (2n) chromosome number of 14.
    
    Which of the following best explains how the sweet pea plants in the parental generation produce (F_1) offspring with 14 chromosomes?
    
    

    1. AA. Meiosis I and II lead to the formation of cells with 14 chromosomes. When two cells combine during fertilization, extra chromosomes are randomly broken down, leading to offspring with 14 chromosomes.
    2. BB. Meiosis I and II lead to the formation of cells with 14 chromosomes. When two cells combine during fertilization, extra chromosomes with recessive traits are broken down, leading to offspring with 14 chromosomes.
    3. CC. Meiosis I and II lead to the formation of cells with 7 chromosomes. During meiosis I, homologous chromosomes separate. During meiosis II, sister chromatids separate. Two cells combine during fertilization to produce offspring with 14 chromosomes.
    4. DD. Meiosis I and II lead to the formation of cells with 7 chromosomes. During meiosis I, sister chromatids separate. During meiosis II, homologous chromosomes separate. Two cells combine during fertilization to produce offspring with 14 chromosomes."
74. 74Which statement about mitotic cell division is incorrect?
    
    
    

    1. AA.DNA is replicated semi-conservatively during mitosis
    2. BB.DNA is normally unchanged from one generation of cells to the next
    3. CC.The same quantity of DNA is distributed to the nuclei of two new cells to produce haploid cells
    4. DD.The daughter cells have the potential to carry out the same function as the parent cell
75. 75Which statement describes interphase of mitosis?
    :
    
    
    

    1. AA.Chromatids are pulled apart by the spindle fibres
    2. BB.Chromosomes start to coil, becoming shorter and fatter
    3. CC.Chromosomes decondense and form chromatin
    4. DD.Chromosomes line up on the equator of the cell
76. 76Vincristine is a chemotherapy drug used to treat cancer. It prevents spindle formation during mitosis.
    
    Which one of these events cannot therefore occur?
    
    

    1. AA. DNA replication
    2. BB. Chromosome coiling
    3. CC. Sister chromatids becoming visible
    4. DD. Sister chromatid separation
77. 77Which processes follows after the M phase of a cell's life cycle?
    
    
    
    
    

    1. AA. Meiosis
    2. BB. Interphase
    3. CC. Mitosis
    4. DD. Cytokinesis
78. 78Choose

    

    1. AA
    2. BB
    3. CC
    4. DD
79. 79During which phase is DNA replicated?
    
    Question 19Select one:
    
    
    
    

    1. AA.M phase
    2. BB.S phase
    3. CC.G2 phase
    4. DD.G1 phase
80. 80Which statement about mitosis is correct?
    
    
    
    
    
    

    1. AA.In telophase chromatids separate
    2. BB.In metaphase the nuclear envelope breaks down
    3. CC.In prophase centrioles separate to the opposite poles of the cell
    4. DD.In anaphase centrosome divide
81. 81When animals undergo mitosis, which structure organizes and produces spindle fibers?
    
    
    
    
    
    

    1. AA.Centrosome
    2. BB.Centromeres
    3. CC.Centrioles
    4. DD.Telomeres
82. 82Choose

    

    1. AA
    2. BB
    3. CC
    4. DD
83. 83Choose

    

    1. AA
    2. BB
    3. CC
    4. DD
84. 84Some chemotherapy treatments used to stop tumor growth work by preventing the DNA double helix from uncoiling and separating. During which stage of the cell cycle would they act?
    
    
    
    

    1. AA.Anaphase
    2. BB.Prophase
    3. CC.Metaphase
    4. DD.Interphase
85. 85What happens to a cell's DNA during metaphase of mitosis?
    

    1. AA.Chromosomes become shorter and thicker
    2. BB.Chromatids reach the poles of the mitotic spindle
    3. CC.Chromosomes line up at the equator of the cell
    4. DD.Each chromosome forms two chromatids
86. 86Strands of DNA molecules which are wrapped around the protein molecules are collectively known as:
    
    
    
    
    
    

    1. AA.Histones
    2. BB.30nm fiber
    3. CC.Nucleosomes.
    4. DD.Chromatin
87. 87CHOOSE

    

    1. AA
    2. BB
    3. CC
    4. DD
88. 88The chemotherapy drug cytarabine is an anti-metabolite similar to the nucleotide cytosine. The drug kills cancer cells by stopping them making and repairing DNA.
    
    At which stage in the cell cycle will cytarabine be incorporated into DNA?
    
    
    

    1. AA. G1
    2. BB. G2
    3. CC. S
    4. DD. M
89. 89A biologist studying corn roots (normally 20 chromosomes) locates a cell in late telophase with only 19 chromosomes. How might this have occurred?
    
    
    
    
    
    
    

    1. AA.Non-disjunction in anaphase
    2. BB.Mutation in interphase
    3. CC.Chromosomal inversion in anaphase
    4. DD.Chromosomal translocation in anaphase
90. 90Which of the following best explains a distinction between metaphase I and metaphase II?
    
    
    
    

    1. AA. The nuclear membrane breaks down during metaphase I but not during metaphase II.
    2. BB. Chromosomes align at the equator of the cell during metaphase II but not during metaphase I.
    3. CC. The meiotic spindle is needed during metaphase I but not during metaphase II
    4. DD: Homologous pairs of chromosomes are aligned during metaphase I, but individual chromosomes are aligned during metaphase II_
91. 91Select one
    
    
    
    
    
    
    

    

    1. AA.4 chromosomes; 8 chromatids
    2. BB.8 chromosomes; 16 chromatids
    3. CC.4 chromosomes; 4 chromatids
    4. DD.8 chromosomes; 8 chromatids
92. 92In which phase is chromosome condensation initiated?
    
    
    
    
    
    

    1. AA. Prophase
    2. BB. Metaphase
    3. CC. Anaphase
    4. DD. Telophase
93. 93Colchicine is a drug that is used to treat inflammation and pain. Its action within the cells is to stop chromatids from separating during mitosis. Which phase will the cell reach and then stop?
    
    
    
    
    
    
    
    
    
    

    1. AA.Metaphase
    2. BB.Telophase
    3. CC.Prophase
    4. DD.Anaphase
94. 94Explain how the orientation of homologous chromosomes during metaphase I of meiosis contributes to greater variation in gametes.

    1. AA. The random alignment of homologous chromosomes at the metaphase plate ensures the random destination of the chromosomes in the daughter cells.
    2. BB. Because homologous chromosomes dissociate from the spindle fibers during metaphase I, they move randomly to the daughter cells.
    3. CC. The homologous chromosomes are paired tightly during metaphase I and undergo crossing over.
    4. DD. Recombination of maternal and paternal chromosomes occurs in metaphase I because the homologous chromosomes are not connected at their centromeres.
95. 95A scientist counted 24 chromosomes in each root cell of a melon plant. How many chromosomes would be observed in a root cell in prophase of mitosis?

    1. AA. 6
    2. BB. 12
    3. CC. 48
    4. DD. 24
96. 96The part labelled X is

    

    1. AA. Chromatid
    2. BB. Parm
    3. CC. centromere
    4. DD. Q arm
97. 97Create the complimentary strand for the DNA strand below.
    
    Make sure to label the parts and direction of the strand. (There should be no space between letters, "-"," ' " or numbers.
    
    5’-AACGGTCCAGTCCAAGTTACG-3’
    [blank_start]3'-TTGCCAGGTCAGGTTCAATGC-5'[blank_end]

    1. A3'-TTGCCAGGTCAGGTTCAATGC-5'
98. 98What molecule is the end product of translation?
    
    
    
    
    

    1. AA.Polypeptide
    2. BB.tRNA
    3. CC.Amino acid
    4. DD.mRNA
99. 99The anticodon of a particular tRNA molecule is:

    1. AA.The part of the tRNA that bonds to a specific amino acid
    2. BB.
       Complementary to the corresponding mRNA codon
    3. CC.
       Complementary to the corresponding triplet in rRNA
    4. DD.
       Changeable, depending on the amino acid that attaches to the tRNA
100. 100The following sequence of codons is from the gene on DNA which codes for part of the hemoglobin molecule, give the hemoglobin gene codons on the mRNA.
     
     CATGTAAATTGAGGACTTCTC
     
     Place NO spaces, commas, brackets or dashes in your answer.
     
     [blank_start]GUACAUUUAACUCCUGAAGAG[blank_end]

     1. AGUACAUUUAACUCCUGAAGAG
101. 101The following sequence of codons is from the gene on DNA which codes for part of the hemoglobin molecule. What is the polypeptide sequence for the genetic information given below?
     
     CATGTAAATTGAGGACTTCTC

     

     1. AA.LYS STOP LYS VAL GLN GLN
     2. BB.VAL HIS LEU THR PRO GLU GLU
     3. CC.VAL PHE LYS LEU LEU ARG Gly
     4. DD.SER GLY LEU SER CYS GLY GLY
102. 102Which site allows the exit of tRNA after termination?

     1. AA. E site
     2. BB. P site
     3. CC. A site
103. 103Which site allows incoming tRNA molecules to attach to the ribosome during protein synthesis?

     1. AA. P site
     2. BB. E site
     3. CC. A site
104. 104In protein synthesis, tRNA carries which triplet nucleotide anticodon to start protein synthesis?
     
     
     [blank_start]UAC[blank_end]
     

     1. AUAC
105. 105Which amino acid is needed for protein synthesis initiation (the amino acid attached to the initiator tRNA)?
     
     [blank_start]Methionine[blank_end]

     1. AMethionine
106. 106Which of the following statements best explains the mechanism for DNA replication?

     1. AA.DNA replication is semi-conservative, because each DNA strand serves as a template during replication
     2. BB.DNA replication is conservative, because one resulting molecule is identical to the original and the other consists of two new strands.
     3. CC.DNA replication is dispersive, because each DNA strand serves as a template during replication.
     4. DD.DNA replication is dispersive, because the two resulting DNA molecules are mixtures of parent and daughter DNA.
107. 107In the image below, which enzyme would be responsible for process below?

     

     1. AA.
        DNA Polymerase
     2. BB.
        DNA ligase
     3. CC.
        RNA polymerase
     4. DD.
        Helicase
108. 108What process is being shown in the image above?

     

     1. AA.
        Transcription
     2. BB.
        Translation
     3. CC.
        Replication
     4. DD.
        Reverse transcription
109. 109The following diagram shows the structure of a tRNA molecule. Which letter, A, B, C or D, indicates the position on the molecule where the amino acid would be attached?

     

     1. AA
     2. BB
     3. CC
     4. DD
110. 110What does structure B represent in the image below?

     

     1. AA. sense strand
     2. BB. Leading strand
     3. CC. Anti -sense strand
     4. DD. Coding strand
111. 111What structure does C represent on the image above?

     1. AA. Lagging Strand
     2. BB. leading stramd
     3. CC. Sense strand
     4. DD. Anti- sense strand
     5. EE. Template strand
112. 112The template strand is read in the
     [blank_start]3'---->5'[blank_end] direction and mRNA is synthesized in
     [blank_start]5'---->3'[blank_end] direction by RNA polymerase.

     1. A3'---->5'
     2. B5'---->3'
     3. C5'---->3'
     4. D3'---->5'
113. 113 The triplet code on the antisense strand of DNA which represents the binding site for RNA polymerase and ensures the proper location for transcription initiation is known as the promoter.
     
     

     1. AVerdadero
     2. BFalso
114. 114The anticodon of a particular tRNA molecule is:

     1. AA.
        The part of the tRNA that bonds to a specific amino acid
     2. BB.
        Complementary to the corresponding triplet in rRNA
     3. CC.
        Changeable, depending on the amino acid that attaches to the tRNA
     4. DD.
        Complementary to the corresponding mRNA codon
115. 115With what mRNA codon would the tRNA in the diagram be able to form a codon-anticodon base pairing interaction?
     
     
     
     
     
     
     
     

     

     1. AA.3'-UAG-5'
     2. BB.3'-ATG-5'
     3. CC.3'-AUG-5'
     4. DD.5'-ATG-3'
     5. EE.3'-GUA-5'
     6. FF.
        5'-AUG-3'
116. 116Which mRNA strand codes for the following polypeptide?
     
     met arg ser leu glu
     
     
     

     

     1. AA.3'-AUGCGUAGCUUGGAGUGA-5'
     2. BB.3'-AGUGAGGUUCGAUGCGUA-5'
     3. CC.5'-AUGCGUAGCUUGGAGUGG-3'
     4. DD.1'-AUGCGUAGCUUGGAGUGA-3'
     5. EE.3'-AUGCGUAGCUUGGAGUGA-1'
117. 117Select one

     

     1. AA
     2. BB
     3. CC
     4. DD
118. 118SELECT ONE

     

     1. AA
     2. BB
     3. CC
     4. DD
119. 119SELECT ONE

     

     1. AA
     2. BB
     3. CC
     4. DD
120. 120Which of the following is not a function of tRNA?
     
     

     1. AA. Helps translate anticodons into amino acids
     2. BB.Peptide bond formation linking amino acid to a polypeptide chain
     3. CC.Carrying a specific amino acid to the ribosome
     4. DD.Recognising codons on mRNA
121. 121During the elongation stage of translation, the ribosome ‘translocates’ along mRNA moving in a 5’ → 3’ direction. What is an immediate effect of this directional movement?
     
     
     

     1. AA. The tRNA occupying P-site moves to A-site
     2. BB. E-site becomes free
     3. CC.The tRNA occupying A-site moves to P-site
     4. DD.Polypeptide chain is released from ribosome
122. 122CHOOSE

     

     1. AA
     2. BB
     3. CC
     4. DD
123. 123What terminates the formation of a polypeptides chain during protein synthesis in cells?

     1. AA.
        When there are no more tRNA molecules
     2. BB.
        Terminator sequence in the DNA
     3. CC.
        When the ribosome reaches a stop codon in the mRNA
     4. DD.
        When RNA polymerase detaches the polypeptide chain from the ribosome
     5. EE.
        When the ribosome reaches the end of the mRNA
124. 124CHOOSE

     

     1. AA
     2. BB
     3. CC
     4. DD
125. 125The following image shows the replication fork. Match the correct labels to the letters in the image below.
     
     
     
     Lagging Strand [blank_start]E[blank_end]
     
     Okazaki fragments [blank_start]A[blank_end]
     
     Leading Strand [blank_start]D[blank_end]
     
     DNA polymerase [blank_start]B[blank_end]
     
     Helicase [blank_start]C[blank_end]

     

     1. AA
     2. BB
     3. CC
     4. DD
     5. EE
     6. FA
     7. GB
     8. HC
     9. ID
     10. JE
     11. KA
     12. LB
     13. MC
     14. ND
     15. OE
     16. PA
     17. QB
     18. RC
     19. SD
     20. TE
     21. UA
     22. VB
     23. WC
     24. XD
     25. YE
126. 126CHOOSE

     

     1. AA
     2. BB
     3. CC
     4. DD
127. 127Which of the following is true about phosphodiester linkage?

     1. Aa) 5’-phosphate group of one nucleotide unit is joined to the 5’-hydroxyl group of the next nucleotide
     2. Bb) 5-phosphate group of one nucleotide unit is joined to the 3-hydroxyl group of the next nucleotide
     3. Cc) 5’-phosphate group of one nucleotide unit is joined to the 3’-hydroxyl group of the next nucleotide
     4. Dd) 3’-phosphate group of one nucleotide unit is joined to the 3’-hydroxyl group of the next nucleotide
128. 128Which of the following enzymes proofreads the DNA?

     1. AA. Primase
     2. BB. topoisomerase
     3. CC. DNA Polymerase
     4. DD. helicase
129. 129CHOOSE

     

     1. AA
     2. BB
     3. CC
     4. DD
130. 130Which of the following bonds are broken during DNA replication?

     1. AA. hydrogen bonds between bases
     2. BB. phosphodiester bonds
     3. CC. covalent bonds between bases
     4. DD. ionic bonds between bases and phosphate groups
131. 131One role of transfer RNA in protein synthesis is to?
     

     1. AA. Deliver amino acids to ribosomes
     2. BB. Terminate elongation of the polypeptide chain
     3. CC. Carry protein building instructions from DNA into the cytoplasm
     4. DD. Act as a supporting framework for polypeptide chains
132. 132The information carried by a DNA molecule is in __________

     1. AA.
        Its amino acid sequence
     2. BB.
        The sugars and phosphates that makes up its backbone
     3. CC.
        The RNA units that make up the molecule
     4. DD.
        The complementary base pairing sequence
133. 133Which of the following is NOT a feature of DNA?

     1. Aa) Base pairs joined by hydrogen bonds
     2. Bb) Monomer is the nucleoside
     3. Cc) Strands are complementary and antiparallel
     4. Dd) Sugar phosphate backbone
134. 134Which of the following is not a nitrogenous base found in DNA?

     1. AA. Adenine
     2. BB. Cytosine
     3. CC. Guanine
     4. DD. Uracil
135. 135Which of the following bonds are broken during DNA replication?
     
     

     1. AA. Glycosidic bonds between bases and phosphate group
     2. BB. Covalent bonds between nitrogenous bases
     3. CC. Phosphodiester bonds
     4. DD. Hydrogen bonds between bases
136. 136CHOOSE

     

     1. AA
     2. BB
     3. CC
     4. DD
137. 137Translation results in the production of:

     1. AA. Protein
     2. Bb. rRNA
     3. CC. mRNA
     4. DD. tRNA
138. 138The sugar molecule in a nucleotide is?

     1. AA. Hexose
     2. BB. Triose
     3. CC. Tetrose
     4. DD. Pentose
139. 139CHOOSE

     

     1. AA
     2. BB
     3. CC
     4. DD
140. 140What is the composition of nucleoside?
     
     
     
     

     1. Aa) a sugar + a phosphate
     2. Bb) a base + a sugar
     3. Cc) a base + a phosphate
     4. Dd) a base + a sugar + phosphate
141. 141CHOOSE

     

     1. AA
     2. BB
     3. CC
     4. DD
142. 142The right strand of a piece DNA contains the sequence A-A-T-G-G-C-C.
     
     What would be the sequence of bases on the complimentary left strand of DNA?
     
     
     
     
     
     

     1. AA.
        A-A-T-G-G-C-C
     2. BB.
        T-T-A-C-C-G-G
     3. CC.
        C-C-G-G-T-A-A
     4. DD.
        T-T-U-C-C-G-G
143. 143If the sequence of the 5'-3' strand is AATGCTAC, then the complementary sequence has the following sequence:
     
     

     1. AA. 3'-AATGCTAC-5'
     2. BB. 3'-CATCGTAA-5'
     3. CC.3'-TTACGATG-5'
     4. DD. 3'-GTAGCATT-5'
144. 144DNA looks like a “twisted ladder”. If the “rungs” of the ladder are made up of nitrogenous bases, what are the hand rails or backbone of the ladder made up of?

     1. AA. Sugars and Salts
     2. BB. Phosphates
     3. CC. Sugars
     4. DD. Sugars and Phosphates
145. 145CHOOSE

     

     1. AA
     2. BB
     3. CC
     4. DD
146. 146The building blocks for nucleic acids are?

     1. AA. Neucleotides
     2. BB. Purines
     3. CC. Pyrimidines
     4. DD. Neucleosides
147. 147Group of adjacent nucleotides are joined by?

     1. AA. Phosphodiester bond
     2. BB. Amide linkage
     3. CC. Glycosidic linkages
     4. DD. Ester Bond
148. 148DNA is made up of Nitrogenous base pairs. The bases bond in which of the following patterns?
     
     
     
     
     
     

     1. AA.) Adenine – Thymine; Cytosine – Guanine
     2. BB.) Adenine – Cytosine; Guanine – Thymine
     3. CC.) Adenine – Guanine; Cytosine – Thymine
     4. DD.) Adenine – Guanine; Cytosine – Taurine
149. 149Transcription results in the production of:

     1. AA. Protein
     2. BB. tRNA
     3. CC. mRNA
     4. DD. DNA
150. 150The two strands in DNA double helix are joined by
     
     
     
     
     

     1. Aa) Covalent bond
     2. Bb) Hydrogen bond
     3. Cc) Ionic bond
     4. Dd) Phosphodiester bond
151. 151On which of the following molecules would you find a codon?

     1. AA. mRNA
     2. BB. tRNA
     3. CC. rRNA
     4. DD. DNA

Descripción

Biology Test sobre Final Exam, creado por Sadiya Williams el 10/02/2024.

Autor

Sadiya Williams

Idioma

English

Visitas

5

Etiquetas

biology

Valoración

Aún sin valoraciones

Valora este test

Valora este test

Más sobre Recombinant DNA and Gene Cloning