Genetic Fingerprinting

Page 1

Genomes Contain Non-Coding Variable Number Tandem Repeats

Not all of an organism's genome (all the genetic material in an organism) codes for proteins.

Some of the genome consists of variable number tandem repeats (VNTRs) - base sequences that don't code for proteins and repeat next to each other over and over (sometimes thousands of times), e.g. CATGCATGCATGCATGCATGCATGCATGCATGCATG is a repeat of the non-coding base sequence CATG.

The number of times these sequences are repeated differs from person to person, so the length of these sequences in nucleotides differs too. E.g. a four nucleotide sequence might be repeated 12 times in one person = 48 nucleotides, but repeated 16 times in another person = 64 nucleotides.

The repeated sequences occur in lots of places in the genome. The number of times a sequence is repeated (and so the number of nucleotides) at different places in their genome can be compared between individuals - this is called genetic fingerprinting.

The probability of two individuals having the same genetic fingerprint is very low because the chance of two individuals having the same number of VNTRs at each place they're found in the DNA is very low.

Page 2

Electrophoresis Separates DNA Fragments to make a Genetic Fingerprint

A sample of DNA is obtained, e.g. from a person's blood.

PCR is used to make many copies of the areas of DNA that contain the VNTRs - primers are used that bind to either side of these repeats and so the whole repeat is amplified.

You end up with DNA fragments where the length (in nucleotides) correpsonds to the number of repeats the person has at each specific position, e.g. one person may have 80 nucleotides, another person 120.

A fluorescent tag is added to all the DNA fragments so they can be viewed under UV light.

The DNA fragments undergo electrophoresis:

The DNA mixture is placed into a well in a lab of gel and covered in a buffer solution that conducts electricity.

An electrical current is passed through the gel - DNA fragments are negatively charged, so they move towards the positive electrode at the far end of the gel.

Small DNA fragments move faster and travel further through the gel, so the DNA fragments separate according to size.

The DNA fragments are viewed as bands under UV light - this is the genetic fingerprint.

Two genetic finger prints can be compared, e.g. if both fingerprints have a bad at the same location on the gel, it means they have the same number of nucloetides and so the same number of VNTRs at that place.

Page 3

Genetic fingerprinting is used to determine relationships and variability

Genetic fingerprinting has many uses, which include:

Determining genetic relationships - we inherit VNTR bases from our parents. Roughly half of the sequences come from each parent. This means the more bands on a genetic fingerprint that match, the more closely related (genetically similar) two people are/ E.g. paternity tests are used to determine the biological father of a child by comparing the genetic fingerprints. If lots of bands on the finger print match, then that person is most probably the child's father. The higher the number of place in the genome compared, the more accurate the result.

Determining genetic variability within a population - the greater the number of bands that don't match on a genetic fingerprint, the more genetically different people are. This means you can compare the number of repeats at several places in the genome for a population to find out how genetically varied that population is. E.g. the more the number of repeats varies at several places, the greater the genetic variability within a population.

Page 4

Genetic Fingerprinting can be used in Forensic Science

Forensic scientists use genetic fingerprinting to compare samples of DNA collected from crime scenes, e.g. DNA from blood, to smaples of DNA from possible suspects, which could link them to the crime scenes.

The DNA is isolated from all the collected samples.

Each sample is replicated using PCR.

The PCR products are run on an electrophoresis gel and the genetic fingerprints produced are compared to see if any match.

If the samples match, it links a person to the crime scene.

Page 5

Genetic Fingerprinting can be used in Medical Diagnosis

In medical diagnosis, a genetic fingerprint can refer to a unique pattern of several alleles.

It can be used tp diagnose genetic disorders and cancer. It's useful when the specific mutation isn't known r where several mutations could have caused the disorder, because it identifies a broader, altered genetic pattern.

EXAMPLE

Preimplantation genetic haplotyping (PGH) screens embroys created by IVF for genetic disorders before they're implanted into the uterus/ The faulty regions of the parent's DNA are used to produce genetic fingerprints, which are compared to the genetic fingerprint of the embryo. If the fingerprints match, the embryo has inherited the disorder. It can be used to screen for cystic fibrosis, Huntington's disease, etc.

Page 6

Genetic Fingerprinting can be used in Animal and Plant Breeding

Genetic fingerprinting can be used on animals and plants to prevent inbreeding, which decreases the gene pool (the number of different alleles in a population). Inbreeding can lead to an increased risk of genetic disorders, leading to health, productivity and reproductive problems. Genetic fingerprinting can be used to identify how closely-related individuals are - the more closely-related two individuals are, the more similar their genetic fingerprint will be. The least related individuals will be bred together.